role of the gastric ecosystem in helicobacter associated gastritis

Yorumlar

Transkript

role of the gastric ecosystem in helicobacter associated gastritis
ROLE OF THE GASTRIC ECOSYSTEM IN HELICOBACTER ASSOCIATED
GASTRITIS
by
JULIA M. SCHMITZ
ROBIN G. LORENZ, COMMITTEE CHAIR
LOUIS B. JUSTEMENT
SUZANNE M. MICHALEK
PHILLIP D. SMITH
CASEY T. WEAVER
A DISSERTATION
Submitted to the graduate faculty of The University of Alabama at Birmingham,
in partial fulfillment of the requirements for the degree of
Doctor of Philosophy
BIRMINGHAM, ALABAMA
2008
ROLE OF THE GASTRIC ECOSYSTEM IN HELICOBACTER ASSOCIATED
GASTRITIS
JULIA M. SCHMITZ
MICROBIOLOGY
ABSTRACT
The second leading cause of cancer death, gastric cancer, is associated with
infection by Helicobacter pylori but the mechanism for the disease is still unknown.
Since infection with H. pylori does not always result in gastric adenocarcinoma in the
mouse; we infect with H. felis which results in gastric adenocarcinoma within twelve to
fifteen months of infection. We hypothesize that Helicobacter-associated gastric
adenocarcinoma is secondary to alterations induced in the protective mucus lining by the
immune response to Helicobacter. Chemokines play a role in the movement and
localization of inflammatory cells in disease. CXCL15, a member of the ELR+ CXC
chemokine family known for neutrophil recruitment, was only expressed strongly in lung.
Due to the common mucosal system of the stomach and the lung, CXCL15 expression
was analyzed in the murine gastrointestinal tract. Strong expression is now reported in the
gastrointestinal, urogenital, and endocrine system. Due to neutrophil infiltrates in H. felis
infection, expression of CXCL15 was analyzed in our gastritis model and was highly
increased after eight weeks. Alterations are seen in the mucin and trefoil factor family in
the human model, but no comprehensive study has been done in the mouse model of H.
felis infection. Analysis of the mucin changes showed that muc5ac was lost in the mouse
model, which mimics the human disease. An increase in the expression of muc4 and
muc5b is evident in the disease, indicating a loss of muc5ac with a gain of muc4 and
ii
muc5b correlating with disease progression. The stomach, which was originally thought
to be a sterile environment, has been shown to contain numerous pathogens. The role of
other microbial components, besides Helicobacter, has not been studied in this disease
model. Through analysis of H. felis infection in a gnotobiotic (B6.GB) model and a
defined flora model (B6.ASF), it was shown that the B6.GB and B6.ASF animals had
similar histology but did not clear the bacteria. This along with an altered expression in
Th17 and Tregs has led to the knowledge that there are several mechanisms for the
gastric histology.
iii
ACKNOWLEDGMENTS
Thank you to my parents, Mike and Winnie, for the guidance and support given to
me through the years. None of this would have been possible without it. You have
inspired me to always better myself, and I owe my successes life to all the sacrifices you
have made for me.
Thank you, Robin, for all your patience, wisdom, guidance, and support
throughout this journey. You kept telling me I could do it, even when I was not sure I
could. You were a wonderful mentor to me and I could not have asked for a better
experience. You have helped me grow into a confident scientist as well as a stronger
person. I am proud to say I was a member of the Lorenz lab.
I like to thank St. Peter‟s Folk Choir – you have become my family away from
home. You have given me the encouragement, support, and love that I needed to make it
through this. I was truly blessed to have been a part of a great group of people and I will
certainly miss you. Thanks also to Jonah, the choir kid, for making me laugh when things
were tough.
Dalia and Djamila, thank you for being my friends and for the support you offered
to me while I was here. I am sure where ever life leads us, we will always make time for
each other and I will forever be grateful for that. To Katy, Laurel, and Jenny, thank you
for your continued support and friendship throughout this time. Who knew when we met
on the first day at Sweet Briar that our friendship would still be going strong no matter
iv
how far apart we are from each other. I am truly blessed to have met you and can not wait
to see where the future will lead us.
Finally to the Lorenz lab, you have offered me the support and friendships needed
to make it through this journey. Thank you to everyone who helped with my project
throughout the years – I could not have done this without you. I wish everyone luck in
their future endeavors.
v
TABLE OF CONTENTS
Page
ABSTRACT ........................................................................................................................ ii
ACKNOWLEDGEMENTS ............................................................................................... iv
LIST OF TABLES ............................................................................................................ vii
LIST OF FIGURES ......................................................................................................... viii
INTRODUCTION ...............................................................................................................1
Helicobacter felis .....................................................................................................2
Mucins and Trefoil Factors ......................................................................................5
Immune Response ....................................................................................................9
Mouse Models ........................................................................................................12
Aims of Dissertation ..............................................................................................15
EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE
GASTROINTESTINAL, UROGENITAL, AND ENDOCRINE
ORGANS ...........................................................................................................................16
ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS
ASSOCIATED WITH GASTRIC HELIOCBACTER INFECTION ...............................51
HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN
GNOTOBIOTIC MICE .....................................................................................................85
CONCLUSIONS..............................................................................................................124
GENERAL LIST OF REFERENCES .............................................................................131
APPENDIX: ANIMAL USE APPROVAL FORM .........................................................139
vi
LIST OF TABLES
Table
Page
ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED
WITH GASTRIC HELIOCBACTER INFECTION
1
Primer-Probe pairs utilized for qRT-PCR...................................................................60
2
Average Fold Change and +/- Range of Mucin Genes ...............................................68
3
Comparison of Human and Murine Mucin Changes ..................................................78
HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC
MICE
1
Primer-Probe pairs utilized for qRT-PCR...................................................................95
2
Average Fold Change and +/- Range of Epithelial Genes ........................................112
3
Average Fold Change and +/- Range of Immune Response .....................................113
vii
LIST OF FIGURES
Figure
Page
INTRODUCTION
1
Diagram of histological changes in C57BL/6 mouse infected with H. felis .................3
2
Histological and colonization scores over the course of infection in
C57BL/6 mice ...............................................................................................................4
3
Muc5ac staining the stomach .......................................................................................8
4
Denaturing Gradient Gel Electrophoresis of DNA isolated from
mock and Helicobacter infected stomachs of B6 mice ...............................................14
EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE GASTROINTESTINAL,
UROGENITAL, AND ENDOCRINE ORGANS
1
Expression of CXCL15 in multiple murine tissues ....................................................28
2
Immunofluorescence analysis of CXCL15 protein expression ..................................29
3
CXCL15 expression in gastric prezymogenic cells ....................................................32
4
Histology and CXCL15 expression in gastric (A, B) and colonic (C-F)
models of inflammation ..............................................................................................36
5
The expression of ELR+ CXC chemokines in select tissues of the
gastrointestinal tract ....................................................................................................38
S1
Expression of CXCL15 (green) was evaluated by immunofluorescence
in the three inflamed models of inflammation ...........................................................49
S2
Immunofluorescent analysis of neutrophils in the gastritis and colitis
Models........................................................................................................................50
ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED
WITH GASTRIC HELIOCBACTER INFECTION
1
Disease progression during H. felis infection in C57BL/6 mice ................................66
2
RNA expression of mucins over the course of infection ............................................69
viii
LIST OF FIGURES (continued)
Figure
Page
3
Immunofluorescent analysis of mucins over the course of infection .........................71
4
Immunofluorescent expression of Muc5ac over the course of the infection ..............73
5
Comparison of mucin expression in C56BL/6 and B6.RAG-1-/infected mice ................................................................................................................74
HELICOBATER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC
MICE
1
Disease progression in B6.SPF, B6.GB, and B6.ASF stomachs
after H. felis infection. ..............................................................................................104
2
DGGE on gastric washes from B6.SPF and B6.ASF infected animals ....................107
3
Muc5ac expression after H. felis infection ...............................................................109
4
Total and H. felis-specific antibody responses after H. felis infection .....................110
5
Immune response after H. felis infection in three different animal models .............114
CONCLUSIONS
1
Diagram of the histological changes in the progression to
gastric adenocarcinoma .............................................................................................130
ix
INTRODUCTION
Gastric cancer is the second leading cause of cancer death worldwide (1-3). There
are two primary types of gastric cancer – diffuse type and intestinal type. Diffuse type
gastric cancer is more common among younger persons and invades the tissues of the
stomach without forming any glands or ulceration. Intestinal type gastric cancer is more
common among the elderly, especially men, and is believed to be a result of a stepwise
progression from normal gastric epithelium to dysplastic epithelium and finally
metaplastic epithelium (1, 2, 4). In the 1980s, Barry Marshall and Robin Warren
discovered a gram-negative bacteria, Helicobacter pylori, showing it caused gastritis. It
was later shown to cause gastric distress such as gastric cancer and ulcers (1, 3, 5).
Although it is known that H. pylori causes gastric cancer, the mechanism by which it
does this is still not known (3). H. pylori is usually acquired during childhood and
persists throughout a lifetime unless eradicated with antibiotics (6). During this
persistence in the human stomach, the host begins to mount an immune response against
the bacteria but never clears the infection. It is thought that this immune response
contributes to the severity of the disease (7). The bacterium is transmitted from person to
person with infection occurring via fecal-oral or gastro-oral route (3). H. pylori has been
shown to be species-specific in that it only colonizes in humans and nonhuman primates.
It is also usually found to be swimming in the mucus layer of the gastric tissue (6). H.
1
pylori uses its flagella to colonize the mucus layer of the stomach and is thus protected by
the mucus from the acidic environment of the stomach, unlike most other bacteria.
Helicobacter felis
As it is difficult to pursue human studies because of the genetic variability
between humans and it is unclear of the exact moment that humans become colonized
with Helicobacter, other models are used to study the disease process of gastric cancer. In
our lab we currently use a H. felis infected mouse model on the C57BL/6 (B6)
background, which closely resembles the human disease in that both human and mice go
through the same histological changes: chronic gastritis, atrophy, metaplasia, dysplasia,
and adenocarcinoma (8, 9). The first histological change, chronic gastritis is persistent
inflammation in the stomach. It is recognized by the inflammatory infiltrates evident
between the stomach glands. This is followed by atrophy where there is a lost specialized
glandular tissue, such as the parietal cells. The stomach will then move into a metaplasia
stage where the stomach actually begins to resemble the intestine, with inflammatory
infiltrates. The next stage of changes is called dysplasia, which is represented by
abnormal growth or development of cells. Finally, the stomach histologically progresses
to adenocarcinoma which is described as an invasion of infiltrates through the muscularis
layer (10). Figure 1 shows the diagram of the histological changes in our C57BL/6 mouse
model that has been infected with H. felis. Interestingly as shown in Figure 2 the
histological score of the C57BL/6 mice increase over the course of infection, the
colonization score for H. felis decreases showing that they are inversely proportional to
each other as is evident in the human model (11, 12). A mouse adapted H. pylori infected
2
Normal
Colonization of H. felis
Chronic gastritis
Atrophy
Metaplasia
Disappearance of H. felis
Adenocarcinoma
Figure 1: Diagram of histological changes in C57BL/6 mouse infected with H. felis.
These changes mimic what is seen in the human disease. The change from normal
stomach to chronic gastritis is marked by inflammation in the stomach as well as the
appearance of H. felis. The next stage, atrophy, is marked by the lost of the parietal cells
which causes an increase in the pH of the stomach. The stomach then moves into a
metaplasia stage where the stomach resembles an intestine. Finally the stomach changes
from metaplasia to gastric adenocarcinoma where there is a clearance of H. felis in the
mouse model.
3
3
2
1
HF Colonization Score
Histological Score
4
9
8
7
6
5
4
3
2
1
0
0
4 weeks
8 weeks
12 weeks
16 weeks
20 weeks
Weeks infected
24 weeks
52 weeks
Histology Score
H. felis Colonization
Figure 2: Histological and colonization scores over the course of infection in C57BL/6
mice. The histological scores are on a 0 – 9 scale (0 = no inflammation; 9 = severe) with
scores of 0 – 3 on the histology of each of the following three areas: longitudinal extent
of inflammation, vertical extent of inflammation, and histological changes. The
colonization scores are on a 0 – 4 scale (0 = no bacteria present; 4 = more than 20
bacteria per gland).
4
C57BL/6 mouse has been studied by other labs, but these mice do not consistently
develop dysplasia and carcinoma (13). In our lab 58% of C57BL/6 mice infected with H.
felis for twelve months will develop gastric adenocarcinoma (unpublished data). Another
lab has infected the mice for fifteen months and shown a 100% development of gastric
adenocarcinoma (8).
In the stomach there are four major differentiated epithelial cell types. The
parietal cells, found mostly in the zymogenic zone and mucoparietal zone (two
continuous zones located at the squamocolumnar junction), possess H+/K+ -ATPase
pumps which are responsible for the production of the acidic environment in the lumen.
The zymogenic (chief) cells, found in the zymogenic zone, secrete proteins such as
intrinsic factor and pepsinogen, which are needed for digestion and absorption of proteins
and vitamins. The last two cell types – surface mucus cells and mucus neck cells –
produce the mucus layer and act to protect the surface of the stomach from the acidic
environment (14). Previous studies have shown that patients in the early stages of the
infection process – chronic gastritis and atrophy – have higher gastric mucosal cell
proliferation and decreased cell numbers of differentiated gastric epithelial cells such as
parietal cells and zymogenic cells (15, 16). With the loss of parietal cells during the
infection, the pH in the stomach increases which could allow other bacteria to be able to
colonize in the stomach.
Mucins and Trefoil Factors
Mucus, a gel-like substance that covers the mammalian epithelial surfaces of
tissues, is composed of mucins and trefoil factors (TFF) (17, 18). Mucus acts as both a
5
lubricant and also as a protective barrier between the contents of the stomach and the
mucosal surface (19). In humans, twenty-one mucins have been identified in tissues such
as lung, nose, salivary glands, and gastrointestinal tract (17, 20). Seven mucins have been
identified in mice (Muc1, 2, 3, 4, 5ac, 5b, and 6) which are homologous to the human
mucins. Mucins consist of a protein backbone with many carbohydrate side chains as
well as tandem repeats of serine, theroine, and proline. There are two types of mucins –
membrane bound (Muc1, 3, and 4) and secreted glycoproteins (Muc2, 5ac, 5b, and 6) (21,
22). The secreted mucins are conserved between the human and mouse forms (23). In
humans, it has been shown that MUC1, MUC5AC, and MUC6 are expressed normally in
the stomach. MUC2, MUC3, MUC4, and MUC5B are not normally expressed in the
human stomach (24-26). Thus far, there have only been mice genetically engineered to
be deficient of Muc1 or Muc2. The Muc1 null mice have been shown to have retarded
development of T-antigen induced primary breast tumors (27). MUC1 was originally
identified to play a role in colorectal cancer, although current studies shows it plays a role
in the formation and progression of gastric tumors (28). Studies with Muc2 null mice
showed that Muc2 plays a role in the suppression of colorectal cancer, as they developed
tumors in the small intestine that progressed to invasive adenocarcinoma and rectal
tumors (29).
In humans and mice there are three trefoil factors (TFF): TFF1/pS2,
TFF2/spasmolytic polypeptide (SP), and TFF3/intestinal trefoil factor (ITF). Trefoil
factors are small, soluble peptides with trefoil or P domain (9). Trefoil peptides are
secreted from the mucus granules of the mucus secreting cells (6). Trefoil peptides act as
scaffolding for the mucins within the stomach with specific TFFs cross linking with
6
mucins to help form the gel layer in the stomach (6, 19). Previous studies in humans
showed that TFF1 interacts with MUC5AC, TFF2 interacts with MUC6, and TFF3
interacts with MUC2 (6, 30). When there is a mucosal injury the trefoils are up-regulated
and begin to stimulate repair in the tissue through epithelial restitution (19). Mice who
are deficient in one of each of the three TFFs have been created (9). The TFF1 deficient
mouse is predisposed to developing gastric cancer after five months (31). The TFF2
deficient mouse shows decreased gastric mucosal proliferations, increased parietal cells,
and increased degree of gastric ulceration after administration of indomethacin (32). The
TFF3 deficient mouse shows sensitivity to colonic injury by standard agents, such as
dextran sulphate sodium, due to the inability to repair the epithelium (33).
Changes have been seen in the mucins and TFFs expressed with Helicobacter
infection. In human gastric cancer, MUC2, MUC3, MUC4, MUC5B, and TFF3 are not
expressed in the normal stomach, but are expressed in a gastric cancer stomach.
MUC5AC and TFF1 are the opposite as each is expressed in a normal stomach but not a
stomach affected with gastric cancer. TFF2 expression is found to be expressed early in
the cancer but is then lost in a stomach at the intestinal metaplasia stage (25, 34-37). One
section of this dissertation aims to characterize the mucins changes in our mouse model
and see how closely they mimic the human changes.
In C57BL/6 mice infected with H. felis we also see the loss of Muc5ac in the
squamocolumnar junction of the parietal zone of the stomach. This mimics what is seen
in the human infection (see Figure 3). We hypothesize that these changes in the mucus
layer are secondary to inflammatory mediators induced by gastric Helicobacter infection.
Kurt-Jones et al. have shown that TFF2-/- infected with H. felis have an increased
7
A
B
Figure 3: Muc5ac staining the stomach. 3A shows muc5ac staining in the B6 mockinfected animal in the gastric body. The score for this section was a 2 out of a score on a
0 – 3 scale (0 = no staining, 1 = is sporadic staining, 2 = medium staining, 3 = bright
staining). 3B shows muc5ac staining in the body of a H. felis infected B6 animal for 16
weeks. This section had a score of a 0. Only stomachs that had a score of 2 or 3 in the
antrum section were evaluated for the lost of muc5ac over time. Bar = 50 microns.
8
susceptibility to gastritis (38). When infected with H. pylori the TFF2-/-mice showed
increased levels of IFN (10).
Immune Response
Cytokines are proteins that cause surrounding immune system cells to become
activated, except for regulatory cytokines which have been shown to inhibit Th1
responses (39). Previous data from other laboratories has shown that the Th1, Th17, and
Treg responses are altered after infection with H. felis (40-42). Th17 effector T cells,
named this because of the production of IL-17, are a recent finding, and its relationship
with the other effector T cell populations, such as Th1 and Tregs are still being
understood. The development of the Th17 cells is inhibited by IFN, but committed Th17
cells are resistant to suppression by cytokines produced by Th1 and Th2 (43). The Th17
cells have also been shown to produce TNF, IL-6, and IL-22 (44-47). As Th17 cells
have been shown to play a role in the development of chronic inflammation in other
inflammatory models, it is thought that they also play a role in H. felis mediated
inflammation (41, 42). IL-17 is a pro-inflammatory cytokine that is made up of six family
members: IL-17A, IL-17B, IL-17C, IL-17D, IL-17E (which is also known as IL-25), and
IL-17F. IL-17A uses IL-17 receptor for signaling. Due to the close homology between
IL-17A and F it is thought that IL-17F may signal through this receptor as well (44, 48).
IL-17 has also been shown to be produced by activated memory T lymphocytes through
regulation by IL-23 and IL-6 (49). Its function appears to be regulation of granulopoiesis
and recruitment of neutrophils to sites of inflammation as it induces the release of CXC
(cysteine-x-cysteine residue) chemokines and TNF in the lung (44, 48, 50). IL-17R
9
knockout mice have enhanced lethality, defective neutrophil recruitment, and defective
granulopoiesis to experimental gram-negative Pneumonia (48).
Small cytokines called chemokines play an important role in the movement and
localization of inflammatory cells in disease (51). IL-17 has been shown to induce the
release of CXC chemokines (50). CXCL15, also known as lungkine or WECHE, is a
member of the ELR+ CXC (ELR is a glutamic acid-leucine-arginine motif immediately
proceeding the CXC sequence) chemokine family (52). It has been previously reported to
be strongly expressed only in the murine lung and weakly in the fetal heart and fetal lung
(53). Previous data has shown that in a murine intestinal injury after ischemia-reperfusion
there was no change in CXCL15 serum levels, while there was change in KC and MIP2,
two other members of the ELR+ chemokines (54). It is reported that CXCL15, in both
normal and inflammatory conditions, plays a role in recruitment of neutrophils. Through
the use of a CXCL15 deficient animal, CXCL15 has been shown to play a role in the
migration of the neutrophils from the lung parenchyma into the airspace (52). Mucins
make up a large part of the lung and the stomach, which are both considered to be part of
a common mucosal system. It is thought that CXCL15 may play a role in neutrophil
recruitment in H. felis infection model (55, 56). Studies in the lung have shown that there
are several cytokines that change the expression of Muc5ac such as IL-17 via IL-6
paracrine/autocrine loop and TNF (49, 57).
An inhibitory cytokine, IL-10 is thought to underlie Treg function in vivo (58).
Current studies suggest that Tregs may be involved in suppressing the immune response
in H. pylori infection (40). IL-10 decreases T cell mediated immunity and initiates a
humoral response (59). IL-10 deficient mice develop a chronic enterocolitis and if
10
stimulated with enteric antigens show an exaggerated immune response in some tissues
(60). IL-10-/- have been shown to have severe gastritis as early as 6 weeks of infection
and eradication of H. pylori early than their wild type counterparts. Thus, IL-10
producing Tregs might play a role in modulating the host response to gastrointestinal
bacteria (61). Schroder et al found that IL-10 is a negative regulator of IFN (62). IFN-
was originally known as a macrophage activating factor, due to the fact that stimulation
of macrophages with IFN induces antimicrobial and antitumor mechanisms (62). IL-12
and IL-18 secretion by antigen presenting cells have been linked to the production of
IFN, resulting in a connection between infection and IFN in innate immune response
(62, 63). In humans, H. pylori causes a strong neutrophil recruitment, as well as increased
IFN response from T cells (64). Other studies have demonstrated that T cell clones have
high levels of production of IFN and TNF (7). IFN-/- mice infected with H. pylori did
not result in gastric inflammation, illustrating a role of IFN- in the induced mucosal
inflammation of H. pylori infection (65). Individuals with IL-1 polymophisms have
been determined by DNA-protein interactions to have an increased risk for gastric cancer
(66). IL-1 is an important pro-inflammatory cytokine and has been identified to be an
inhibitor of gastric acid secretion (67, 68). Early in the infection with H. pylori it has
been shown that IL-1, IL-6, and TNF are the proinflammatory cytokines produced (69).
With the above mentioned cytokines and chemokines being increased with infection, it is
hypothesized that they are key to the changes observed in the mucins at later time points.
11
Mouse models
Different animal models have been infected in our lab. B6.RAG-1-/(recombination activating gene) infected with H. felis resulted in high levels of
colonization but no histological changes (70). These mice are B and T cell deficient (71).
Infection of B6.129S2-Igh-6tm1Cgn (B6.MT) results in severe gastric pathology as seen in
the B6 model although it doesn‟t result in gastric adenocarcinoma after one year of
infection (70). B6.mT mice are B cell deficient (72). These results prove that T
lymphocytes are important in creating the gastric pathology seen in the H. felis infection
(70). An adoptive transfer model has been used in our lab where lymphocytes are
obtained from C57BL/6 mice and donated into B6.RAG-1-/- mice that have already been
infected with H.felis for two weeks. The B6.RAG-1-/- mice are sacrificed six weeks after
the lymphocyte transfer, resulting in severe gastritis, which is similar to what is seen in
C57BL/6 mice infected for twelve weeks with H. felis (73). When the B-lymphocyte
population was depleted, so only CD3+ were donated into the B6.RAG-1-/- mice, there
was no difference in the histological scores from mice that had whole lymphocytes
donated into them. This proves that T cells are sufficient for the gastric pathology. When
the T lymphocytes were separated into CD4+ spleenocytes or CD8+ spleenocytes and
donated in to the B6.RAG-1-/- separated, the CD4+ cells caused the same severe disease
seen in the C57BL/6 mice. This proves that CD4+ cells are important for the gastric
pathology seen (73). By using these different animal models more information can be
gathered on the infection process by comparing the immune response and mucin changes
in these animals.
12
During the progression to gastric cancer, the parietal cells are lost during the
gastric atrophic stage (8, 10). The loss of parietal cells causes an increase in pH, which
could then allow other bacteria that could not normally colonize in the stomach, because
of the acidic environment, thrive in the stomach (74, 75). Previous unpublished data in
our lab has shown that B6 mice infected with H. felis for eight weeks have bacterial
bands not present in the mock animals by denaturing gradient gel electrophoresis (Figure
4). There are two valuable mouse models to analyze what happens with H. felis infection
without these additional bacteria which allows us to begin to understand the role of other
microbial components in the disease progression to gastric adenocarcinoma. Germ-free
mice are absent of all types of bacteria and, thus, allow the researcher to study the effect
of a specific bacteria or the interrelationship between two different bacteria in the system
(76). By infecting these mice with H. felis, we can begin to understand if alterations in
the gastric microbiota are important in gastric pathology. The gnotobiotic mice are
critical to understanding the effects of a single bacterium on the environment; however,
this does not mimic a normal environment. Another valuable type of mouse model is the
defined flora mouse, otherwise known as Altered Schaedler Flora. The ASF mouse
contains a cocktail of eight known various bacteria that were originally inoculated into a
germ-free mouse, such as two Lactobacillus strains, a Bacteroides strain, a Clostridium
cluster, a Flexistipes species, and a low G+C content gram positive bacteria (77-79). It
has been shown that approximately 1.59 x 106 bacteria/gram of the ASF are present in the
glandular stomach (78). By infecting the ASF mice with H. felis we can determine if any
of the eight bacteria are sufficient to cause the gastric and mucin alterations seen in the
B6 mouse model of infection.
13
Mock
infected
HF
infected
HF
H. felis band
Figure 4: Denaturing Gradient Gel Electrophoresis of DNA isolated from mock and
Helicobacter infected stomachs of B6 mice. The first three lanes are B6 mock infected
stomachs. The next three lanes are the B6 infected with H. felis for eight weeks stomachs.
Notice the additional bands indicated by the circle that are not present in the mock
infected stomachs. As a positive control DNA was isolated from a pure culture of H. felis.
The band is indicated by the arrow and can only be seen in the Helicobacter infected
animals.
14
Aims of Dissertation
We hypothesize that Helicobacter-associated gastric adenocarcinoma is
secondary to alterations induced in the protective mucus lining by the immune response
to Helicobacter. The goals of this dissertation are: to analyze the expression of CXCL15
in the gastrointestinal tract, to document the immune and mucins changes over the course
of infection in the mouse model as compared to the human disease, and to analyze the
effects of H. felis on the system in a gnotobiotic model and a defined flora model.
15
EXPRESSION OF CXCL15 (LUNGKINE) IN MURINE GASTROINTESTINAL,
UROGENITAL, AND ENDOCRINE ORGANS
by
JULIA M. SCHMITZ, VANCE J. McCRACKEN, REED A. DIMMITT, ROBIN G.
LORENZ
Journal of Histochemistry and Cytochemistry Volume 55(5): 515 – 524, 2007
Copyright
2007
by
Journal of Histochemistry and Cytochemistry
Used by permission
Format adapted for dissertation
16
ABSTRACT
The ELR+ chemokine CXCL15, which recruits neutrophils during pulmonary
inflammation, is also known as lungkine due to its reported exclusive expression in the
lung. We now report that CXCL15 mRNA and protein is also expressed in other mucosal
and endocrine organs, including the gastrointestinal and urogenital tracts and the adrenal
gland. Our results indicate that CXCL15 is expressed throughout the gastrointestinal
tract, with the exception of the cecum. Gastric CXCL15 protein expression is
approximately ten-fold lower than pulmonary expression, and primarily occurs in a
specific lineage of gastric epithelial cells, the pre-zymogenic and zymogenic cell. Similar
to the increased expression of CXCL15 during pulmonary inflammation, gastric
inflammation induced by infection with Helicobacter felis caused an increase in gastric
CXCL15 expression. However, colonic CXCL15 expression was not altered in two
different models of colonic inflammation, the Helicobacter hepaticus T-cell transfer
model and the mdr1a-/- model of colitis. These findings clearly demonstrate that
CXCL15, previously reported to be the only lung-specific chemokine, is also highly
expressed in other murine mucosal and endocrine organs. The functional role of
CXCL15 in mucosal disease remains to be elucidated.
17
INTRODUCTION
Chemokines are small cytokines that play an important role in the movement and
localization of inflammatory cells in disease (1). Murine CXCL15, also known as
lungkine or WECHE (WEird CHEmokine), was first described as a protein secreted into
the airway spaces, which induced neutrophil migration (2, 3). Its protein structure
contrasts with other CXC chemokines, as it contains an extended C-terminal domain of ~
65aa. It also has the novel function of regulating hematopoietic differentiation into
erythroid cells and acting as a chemoattractant for bone marrow progenitor cells (Ohneda
et al. 2000). CXCL15 is part of the ELR+ CXC chemokine family, whose members
contain a nonconserved amino acid between the first two cysteines (CXC), as well as a
conserved ELR motif (glutamic acid-leucine-arginine) immediately preceding the CXC
sequence (4, 5). Chemokines in the CXC family are involved in the recruitment of
neutrophils, and can promote angiogenesis (5-7). Members of the human ELR+ CXC
chemokine family include CXCL1 (GRO-), CXCL2 (GRO-), CXCL3 (GRO-),
CXCL5 (ENA-78), CXCL6 (GCP-2), CXCL7 (NAP-2), and CXCL8 (IL-8). Mouse
ELR+ CXC chemokines include keratinocyte-derived chemokine (KC),
lipopolysaccharide-induced CXC chemokine (LIX), and macrophage inflammatory
protein (MIP-2). Human ELR+ chemokines primarily bind to the receptor CXCR2,
which promotes the chemotactic and angiogenic activity of these chemokines; however,
CXCL6 and CXCL8 also bind CXCR1, which predominantly plays a role in neutrophil
chemotaxis (5, 7). The mouse ELR+ chemokines (LIX, KC, MIP2) also primarily bind to
CXCR2. In addition MIP-2 can bind to CXCR1 (6). The presence of CXCR1 receptor in
18
mice has been a controversial subject but recent findings suggest there is a human
ortholog in the mouse (8). The receptor for murine CXCL15 has yet to be determined;
however it appears not to bind human CXCR1 / CXCR2 or murine CXCR2 (2). There is
no known human homologue of CXCL15.
CXCL15 has been reported to be strongly expressed in the adult lung of the
inbred mouse strains BALB/c and C57BL/6, but does not appear to be expressed in
lymphoid organs such as the spleen (2, 3). CXCL15 is upregulated in response to
multiple inflammatory stimuli, including an ovalbumin-induced model of asthma, and in
Nippostrongylus brasiliensis or Aspergillus infection models (2). In these models,
CXCL15 is believed to be released by bronchoepithelial cells into the airways, where it
functions to increase the migration of neutrophils into the airway spaces (2). Additional
support for a role of CXCL15 in pulmonary defense comes from studies using Klebsiella
pneumoniae–infected mice deficient in CXCL15 (2, 4). Compared to infected wild-type
controls, CXCL15-/- mice had an increased pulmonary bacterial load and decreased
survival.
In contrast to the role of CXCL15 in murine models of asthma and pulmonary
infections, murine intestinal injury after ischemia-reperfusion resulted in no change in
CXCL15 serum levels, although the expression of other ELR+ chemokines, KC and
MIP2, was dramatically increased (9). Although the CXCL15 serum levels did not
change, the baseline serum level of CXCL15 was ten times greater than the serum
concentrations of KC and MIP-2. As pulmonary CXCL15 was believed to only be
secreted into the airspaces, we decided to more fully investigate the possibility that
secretion of CXCL15 could occur in other mucosal or endocrine organs.
19
MATERIALS AND METHODS
Mice
Five inbred mouse strains were used in this study; all mice were between 6 and 10
weeks old at the time of baseline analysis or initial infection, unless otherwise indicated.
C57BL/6J, C57BL/6J-Rag-1tm1Mom (B6.Rag-1-/-), and BALB/cJ were obtained from The
Jackson Labs, Bar Harbor, MA, and FVB/N mice and FVB.mdr1a-/- mice were obtained
from Taconic, Hudson, NY. Mice were maintained on a 12:12-h light-dark schedule and
fed standard laboratory mouse chow. Animal procedures and protocols were conducted
in accordance with the Institution Animal Care and Use Committee at the University of
Alabama at Birmingham (Birmingham, AL).
Antibodies and Reagents
Primary antibodies used in this study include: mouse anti-H+/K+ -ATPase (Clone
2G11; Sigma; St. Louis, MO), rabbit anti-intrinsic factor (IF; generous gift of David
Alpers, Washington University Medical School, St. Louis, MO; 1:2000), rabbit antipepsinogen (generous gift of Michael Samloff, UCLA; Los Angeles, CA; 1:2000), and
biotinylated goat anti-mouse CXCL15 which showed no cross reactivity with other
chemokines and cytokines as tested by R&D Systems (R&D Systems DuoSet Part
840950; Minneapolis, MN; 0.5 g/mL). Fluorescently-labeled lectins used in this study
were rhodamine Cholera toxin B (CTB; List Biological; Campbell, CA; 4 g/mL) and
Texas Red Griffonia simplicifolia (TX R GSII; EY Laboratories, Inc.; San Mateo, CA;
1:200). Secondary and detection antibodies used included: Cy3 goat anti-mouse Fab
20
fragment (Jackson ImmunoResearch; West Grove, PA), biotin donkey anti-rabbit IgG
(Jackson ImmunoResearch; 5.6 g/mL), streptavidin-HRP (Jackson ImmunoResearch; 1
g/mL), and FITC or Cy3-Tyramide diluted per manufacturer‟s instructions
(PerkinElmer; Boston, MA; 1:100 and 1:1000 respectively). Nuclei were visualized by
Hoechst dye (Sigma; St. Louis, MO; 2 g/mL).
Tissue Preparation
Immediately after sacrifice by isofluorane inhalation and cervical dislocation,
tissues were removed for total RNA isolation and immunohistochemistry. All tissues
removed were divided in half, with one half immersed in liquid nitrogen for total RNA
isolation, while the other was submerged in Bouin‟s Fixative Liquid (Fisher Scientific;
Pittsburgh, PA). The tissues were immersion fixed for 18-24 hours at 4oC, changed to
70% ethanol, placed in cassettes, and embedded in paraffin. Five-micron sections were
prepared on a microtome and attached to pre-cleaned microscope slides (Snowcoat X-tra,
Surgipath; Richmond, IL).
Total RNA was isolated by the Trizol® method (Invitrogen; Carlsbad, CA), which
uses phenol and guanidine isothiocyanate for total RNA extraction (10). Prior to cDNA
synthesis, genomic DNA was removed from the extracted total RNA using the Turbo
DNase kit (Ambion, Austin, TX). Using equivalent amounts of mRNA (2 g), cDNA
was made utilizing reverse transcription with the Transcriptor First Strand cDNA
Synthesis Kit (Roche, Pensberg, Germany). Quantitative real-time reverse transcription
polymerase chain reaction (qRT-PCR) was performed using Applied Biosystems AssaysOn-Demand primer/probe sets and TaqMan Universal PCR Mix (PE Applied
21
Biosystems; Foster City, CA) combined with the Stratagene MX3000P real-time PCR
machine. The following Applied Biosystems Assays-On-Demand primer/probe sets were
used: 18S housekeeping gene (Hs99999901_s1; GeneBank ID#X03205), CXCL15
(Mm00441263_m1; GeneBank ID#NM 011339.1), CXCL1/KC (Mm00433859_m1;
GeneBank ID#NM 008176), CXCL5/LIX (Mm00436451_g1; GeneBankID#NM
009141), and CXCL2/MIP2 (Mm00436450_m1; GeneBankID#NM 009140). Gene
expression was calculated using the “delta-delta Ct” relative quantitation method as
detailed by Applied Biosystems (Manufacturer‟s instructions; Applied Biosystems).
Briefly, the relative expression (Ct) of each target gene is determined by comparing its
crossing threshold (Ct) to the Ct for reference or housekeeping gene. For our studies, we
chose 18S as the reference gene, as our pilot study (unpublished results), combined with
other published results, indicates that several commonly utilized reference genes, such as
GAPDH, HPRT, and -actin are altered during inflammatory states in the gastrointestinal
tract (11). The Ct from each sample was then compared to an experimentally defined
control to determine the Ct, which is used in the formula 2Ct to determine the fold
change in mRNA expression (11, 12).
To quantify the amount of CXCL15 protein in the various organs, protein was
isolated from multiple C57BL/6 tissues. Briefly, the tissues were placed in a buffer of
500 mM NaCl/50 mM Hepes, pH 7.4 containing 0.1% Triton X-100, 0.02% NaN3 (Fisher
Scientific, Pittsburgh, PA), and protease inhibitor cocktail for mammalian tissues (Sigma,
St. Louis, MO; p8340). The tissues were then homogenized followed by an overnight
freeze at -20oC. After thawing the tissue extracts were spun at 6000 x g for 20 minutes at
4oC (13). The supernatant protein concentration was determined by the Bio-Rad Protein
22
Concentration Assay following the DC Protein Assay Instruction Manual (catalog #5000116; Bio-Rad Laboratories, Hercules, CA). To determine the amount of CXCL15
expressed in each tissue, routine ELISAs were performed on triplicate samples according
to the manufacturer‟s protocol (R&D Systems; Minneapolis, MN). The optical density of
the samples was read on a VERSAmax® microplate reader (Molecular Devices,
Sunnyvale, CA) and the data were analyzed with Soft Max Pro 4.7®. The limit of
detection for this assay was 200 pg/mL.
Immunofluorescence Staining
Immunofluorescence staining for CXCL15 was performed on paraffin-embedded
tissues. Briefly, the tissues were deparaffinized with Citrosolv (Fisher Scientific), and
isopropanol, and rehydrated with phosphate buffered saline (PBS). The tissues then went
through a 3% hydrogen peroxidase step for five minutes to block endogenous
peroxidases, and an antigen retrieval step (0.1 M citric acid, 0.1 M Na citrate boiled for
17 minutes) to unmask epitopes. Next, the tissues were blocked with avidin and biotin
(Vector catalog # SP-2001; Burlingame, CA) each for fifteen minutes. The last blocking
step was a PBS-blocking buffer (which consists of 1% bovine serum albumin and 0.3%
Triton) for fifteen minutes to block non-specifically binding proteins and to provide
antibodies access to cell surface and internal antigens. After the above blocking steps,
slides were incubated with biotinylated anti-mouse CXCL15 (R&D Systems) primary
antibody (overnight at 4oC), followed by streptavidin-HRP, with detection by FITC
Tyramide.
23
The mouse anti-H+/K+ -ATPase was detected using a “mouse on mouse” protocol
with detection by Cy3 goat anti-mouse Fab Fragment (14). Briefly the slides are blocked
with PBS-blocking buffer for an hour. During this hour the primary and secondary
antibodies are incubated together at a 1:2 ratio for forty minutes at room temperature and
then blocked with excess serum to block the unbound Fab fragments for ten minutes
before being placed on the slide. Detection of the primary rabbit anti-IF and -pepsinogen
was by a biotin donkey anti-rabbit IgG, followed by a streptavidin-HRP step, and finally
a Cy3 Tyramide step. For the IF, pepsinogen, CTB, and TX R-GSII costaining
experiments with CXCL15, the primary antibodies were added together and the CXCL15
staining was taken through to detection (FITC Tyramide) followed by an additional 3%
hydrogen peroxidase step before detection of the other primary antibody. For the H+/K+ ATPase and CXCL15 costaining experiment, the CXCL15 staining protocol was taken
through to detection, then the slides were blocked for the “mouse on mouse” protocol,
and then the H+/K+ -ATPase/Cy3 FAB fragment complex was added.
To determine the specificity of the CXCL15 immunostaining pattern, a
preabsorption control was performed (15). Briefly, a two-fold excess (on a weight basis)
of the recombinant mouse CXCL15 (100 l of 1 g/ml; R&D Systems; Minneapolis,
MN) was preincubated with the biotin goat anti-CXCL15 (1 l of 50 g/ml) for one hour
at 37oC. This preincubation mixture was then placed on the slide in place of the primary
antibody and the rest of the steps were carried out as described above. For all staining
protocols, a slide was done with no primary antibodies to confirm the staining seen was
real.
24
Helicobacter felis Infections
C57BL/6J mice were infected with H. felis or mock-infected as described
previously (16). Briefly, mice were infected orally with 5 X 107 CFU H. felis (ATCC
49179) per inoculation in 25 l of brain-heart infusion broth (BHI)/glycerol three times
over a one week period. This protocol results in 100% infection efficiency in our
laboratory. The mock-infected mice were inoculated with freezing medium, a sterile
BHI/glycerol mixture.
Colitis Models
Colitis was induced in Helicobacter hepaticus-infected B6.Rag-1-/- mice using a
previously described model, with minor modifications (17). Adult B6.Rag-1-/- recipient
mice, certified free from Helicobacter by the supplier, were infected orally three times
over a seven-day period with 5 x 107 CFU H. hepaticus (ATCC 51488) resuspended in 25
l freezing medium. H. hepaticus was cultured on Brucella blood agar (Difco; Kansas
City, MO) and inoculated into Brucella broth containing 5% fetal calf serum for
infections as described previously (18). Lymphocytes were isolated from spleens and
mesenteric lymph node of uninfected C57BL/6J mice by mechanical dissociation
followed by lysis of erythrocytes and purification for CD4+ T cells using magnetic
microbeads coated with rat anti-mouse CD4 (L3T4; Miltenyi Biotec, Auburn, CA).
CD4+ T cells (4 x 105) from uninfected C57BL/6J mice were injected i.p. into two-week
H. hepaticus infected or mock-infected B6.Rag-1-/- mice. The animals were followed for
an additional six weeks by closely monitoring for weight loss and diarrhea. At sacrifice,
the colons of recipient mice were excised, processed, and stained with hematoxylin and
25
eosin; portions of each tissue were also stored in LN2 for subsequent mRNA analysis as
described above.
The second model of colitis utilized in this study was the FVB.mdr1a-/- mouse
(19). In the FVB.mdr1a-/- mouse model, the absence of intestinal P-glycoprotein leads to
severe colonic inflammation (19). To assess the involvement of CXCL15 in this model
of IBD, FVB.mdr1a-/- and FVB control mice were sacrificed at 5 months of age. Their
colons were excised, processed, and stained with hematoxylin and eosin; portions of each
tissue were also stored in LN2 for subsequent mRNA analysis as described above.
Graphic and Statistical Analysis
Graphs of the calculated mean fold change from the RT-PCR were created using
GraphPad Prism 4® (GraphPad Software; San Diego, CA). All qRT-PCR graphs are
organized horizontally and with the y-axis at one to represent the baseline expression of
each gene for the comparison, except for Figure 1A, which is normalized to lung. Error
bars represent the standard error between fold changes. Statistics were performed for all
RT-PCR and ELISA experiments using Sigma Stat v. 2.03 ® and results were graphed
with GraphPad Prism 4®. A student‟s t-test was performed to determine statistical
significance which was defined as P < 0.05.
26
RESULTS
CXCL15 Expression in Murine Mucosal and Endocrine Tissues
We examined the level of CXCL15 mRNA expression in mucosal and endocrine
organ systems of the C57BL/6J mouse. Figure 1 (top) shows the mRNA expression levels
of CXCL15, graphed as a ratio against the expression seen in the lung. Although the
highest expression of CXCL15 is found in the lung, there is significant expression in
adrenal glands and in multiple mucosal organs, including the respiratory, gastrointestinal,
and urogenital tracts. There was minimal to no expression of CXCL15 detected in the
cecum, testes, or spleen (Figure 1 top and data not shown). The expression of CXCL15
by RT-PCR was tested on the same tissues from BALB/cJ and FVB/N mice and the
expression level was similar to those shown for the C57BL/6J mice (data not shown).
To validate the qRT-PCR expression, total protein was isolated from C57BL/6J
tissues and CXCL15 protein expression was determined by ELISA. As was predicted by
the mRNA analysis, the lung expressed high levels of CXCL15 protein; however
surprisingly on a per mg basis, the adrenal gland actually expressed the highest level of
CXCL15 protein (Figure 1, bottom). CXCL15 protein was not observed in the ileum and
cecum.
To determine the pattern of CXCL15 protein expression, several tissues were
analyzed by immunofluorescent staining. As can be seen in Figures 2A-D, tissues
expressing CXCL15 mRNA all demonstrated CXCL15 immunoreactivity as detected by
a biotin-goat-anti-mouse CXCL15 antibody. This included the adrenal gland, trachea,
colon, and uterus. In the adrenal gland, staining for CXCL15 was concentrated in the
27
Figure 1: Expression of CXCL15 in multiple murine tissues. Top: The mRNA
expression of CXCL15 in mucosal and endocrine tissues of 12-week-old C57BL/6 mice.
Expression is graphed as a ratio of lung CXCL15 expression. Expression was similar for
FVB/N and BALB/c mice (data not shown). As previously reported, the lung has a high
level of expression of CXCL15, but here we also demonstrate significant levels of
expression in other mucosal and glandular organs, including trachea, stomach, jejunum,
and adrenal gland. Bottom: CXCL15 protein expression was determined by ELISA.
High protein expression is seen in the lung, adrenal gland, and other mucosal tissues (n =
3). *p < 0.05 as compared with lung.
28
Figure 2: Immunofluorescence analysis of CXCL15 protein expression. (A) Expression
of CXCL15 (green) in the adrenal gland of a C57BL/6 mouse. Bright staining is seen in
the pan-cortex, with increased intensity in the zona glomerulosa. All sections were
counterstained with the nuclear dye, Hoechst 33258 (blue). (B) CXCL15 (green)
immunoreactivity in the trachea of C57BL/6 mouse. (C) CXCL15 (green) can be seen in
the colonic goblet cells as indicated by the arrow. (D) Expression of CXCL15 (green) in
the uterus of a C57BL/6 mouse. (E) CXCL15 immunoreactivity (green) is seen in the
alveolar and bronchoepithelial cells of the lung of a C57BL/6 mouse. Staining was done
on a BALB/c and FVB mouse lung fixed in Bouins, and the staining was the same as the
C57BL/6 mouse lung (data not shown). (F) Anti-CXCL15 immunoreactivity in the lung
is blocked by pre-incubation with CXCL15 protein, demonstrating antibody specificity.
Bar = 50 m.
29
pan-cortical region, with increased intensity in the zona glomerulosa (Figure 2A). In the
trachea, CXCL15 is located in the pseudostratified epithelial cells (Figure 2B). In Figure
2C, CXCL15 can be found in the upper part of the colonic gland as well as in the colonic
goblet cells. In the uterus, CXCL15 is observed in the endometrium (Figure 2D). The
spleen did not show positive immunostaining for CXCL15, confirming the lack of
mRNA expression (data not shown).
Specificity of CXCL15 Immunofluorescence in Pulmonary Tissue
Since the expression of CXCL15 protein had been previously demonstrated only
in BALB/c lung bronchoepithelial cells, we wanted to determine if our biotinylated goatanti-mouse CXCL15 detected a similar staining pattern in C57BL/6J lung tissue (2). As
can be seen in Figure 2E, there is expression of CXCL15 in the C57BL/6J lung in cells in
both the lung parenchyma and bronchoepithelial cells. Expression of CXCL15 was also
analyzed in BALB/cJ and FVB/N mouse lungs, and a similar pattern of expression was
seen (data not shown). To determine if the lung parenchymal cells stained by CXCL15
were bone marrow derived, cells were co-stained with antibodies to CD45+; there was no
co-localization of the two stains (data not shown). Antibody blocking studies were
performed to determine the specificity of the immunofluorescence. After preincubation
of the CXCL15 antibody with CXCL15 peptide, no immunofluorescence was detected in
the lung, indicating that the immunofluorescence was specific for CXCL15 (Figure 2F).
30
CXCL15 Expression in Gastric Epithelial Cells
As our laboratory has extensive expertise in the study of gastric epithelial biology,
we next performed double immunofluorescent studies to determine the exact expression
pattern of CXCL15 in the stomach (20). The two mucus producing cell types – surface
mucus cells and mucus neck cells – produce mucin and trefoil factors that form the
mucus layer, which acts to protect the surface of the stomach from the acidic luminal
environment (21). These cells are identified by their expression of mucin glycoproteins
which react with the cholera toxin B (CTB) subunit (Figure 3A) and the lectin GSII
(Figure 3G), respectively (20). The parietal cells, found mostly in the zymogenic zone
and mucoparietal zone, express H+/K+ -ATPase, which is responsible for the production
of the acidic environment in the lumen (Figure 3D). The zymogenic (chief) cells that are
found in the zymogenic zone secrete proteins, such as pepsinogen (Figure 3J) and
intrinsic factor (Figure 3M), needed for digestion and absorption of vitamin B12
respectively. Based on Figures 3C, F, I, L, and O, it can be seen that CXCL15
immunostaining colocalized with a subset of cells expressing pepsinogen and intrinsic
factor. This staining pattern identifies the CXCL15 expression gastric cell type as the
pre-zymogenic and zymogenic cell. CXCL15 does not appear to be expressed by parietal
cells, surface mucus cells or the pure mucus neck cell population.
Expression of CXCL15 in H. felis-infected Mice
Since chemokines play a role in the movement of inflammatory cells, the
expression of ELR+ CXC chemokines was analyzed in our H. felis model of gastric
31
32
Figure 3: CXCL15 expression in gastric prezymogenic cells. (A – C) Identification of
surface mucus cells through lectin staining with CTB (red in A), indicates that CXCL15
(green in B) is not expressed in surface mucus cells. (D – F) H+/K+ -ATPaseimmunoreactive parietal cells (red in D) and CXCL15-immunoreactivity (green in E) do
not colocalize (F), indicating that parietal cells do not express CXCL15 protein. (G – I)
GSII lectin reactivity (red in G) identifying pure mucus neck cells demonstrates that
CXCL15 (green in H) is also not expressed in the main mucus neck cell population. (J –
L) Pepsinogen immunoreactivity (red) is seen in a subset of mucus neck and zymogenic
cells (red in J). This staining pattern is similar to CXCL15 (green in K) and expression
between pepsinogen and CXCL15 is colocalized in panel L (yellow). (M – O)
Immunolocalization of intrinsic factor (M, red) in zymogenic cells and CXCL15 (green
in N), indicates a limited number of cells showing colocalization. The arrow in O
indicates the positive colocalization staining between the two. These results are consistent
with the expression of CXCL15 in pre-zymogenic cells that are in the process of
differentiating into mature zymogenic cells. Bar = 50 m.
33
inflammation. This model develops a severe chronic active gastritis that is responsible
for a series of epithelial alterations, including atrophy, metaplasia, and dysplasia, which
ultimately results over 12-15 months in gastric adenocarcinoma formation (16, 22, 23).
Figure 4A shows the normal stomach glandular zone of an 8-week mock-infected
C57BL/6 stomach, while Figure 4B demonstrates the dramatically altered epithelial
glandular architecture and inflammatory infiltrate in the stomach of a C57BL/6J mouse
infected with H. felis for eight weeks. Figure 4G shows that CXCL15 mRNA expression
is increased in 8-week H. felis infected stomachs, when compared to the CXCL15
expression in 8-week mock C57BL/6 stomachs (the mock experimental control was
assigned a fold change of 1). Supplemental Figure 1 shows CXCL15 immunofluorescent
staining in a mock (1A) and H.felis infected stomach (1B). At this timepoint, there is a
loss of zymogenic cells and a massive expansion of the dysplastic mucus neck cell
population. This dysplastic population shows a diffuse staining of CXCL15, which
correlates with the increase in mRNA expression shown in Figure 4G.
Expression of CXCL15 in Two Murine Models of Colitis
Currently our laboratory investigates two mouse model of inflammatory bowel
disease. One model utilizes the FVB.mdr1a-/- mouse (multidrug-resistance gene), which
spontaneously develops intestinal inflammation if housed under specific pathogen-free
conditions (19). The mdr1a gene encodes a 170 kDa transmembrane transporter protein
known as P-glycoprotein, which is part of the adenosine triphosphate binding transporter
family and found in the murine distal small intestine and colon (24, 25). The second
model of IBD involves the transfer of regulatory T cell-deficient lymphocyte subsets into
34
immunodeficient B6.Rag-1-/- mice. Different permutations of this model include transfer
of CD45RBhi or CD62L-enriched T cells, as well as T cells from regulatory cytokinedeficient mice (26-28). In these studies we used a previously reported model of colitis
induction in which transfer of CD4+ T cells from uninfected C57BL/6 donor mice
induces colitis upon transfer to Helicobacter hepaticus-infected, immunodeficient
B6.Rag-/- mice (17).
Colonic expression of CXCL15 was tested in both of these models and
surprisingly the expression was decreased in mice with severe colitis, the opposite of our
results in the gastritis model (Figure 4G). Figure 4C shows the normal uninflamed colon
from an FVB/N mouse and 4D demonstrates the extensive inflammatory infiltrate and
gland thickening that spontaneously occurs in a 6 month old FVB.mdr1a-/- mouse. Figure
4E shows an absence of inflammation in a mock-infected B6.Rag-1-/- recipient of CD4+ T
cells that do not develop diarrhea or colitis. However, the colon from an H. hepaticusinfected B6.Rag-1-/- recipient of CD4+ T cells, that do develop diarrhea, demonstrates
severe intestinal inflammation (Figure 4F). Supplemental Figure 1 shows the expression
of CXCL15 by immunofluorescence in these two colitis models. Unlike the gastritis
model it can be seen that the protein level of CXCL15 is unchanged or slightly decreased
with colitis, correlating with the mRNA data in Figure 4G.
ELR+ CXC Chemokine Expression in Gastric and Intestinal Models of
Inflammation
As CXCL15 is a member of the ELR+ CXC chemokine family, we contrasted its
expression in our gastric and one of our intestinal models of inflammation with the other
35
36
Figure 4: Histology and CXCL15 expression in gastric (A, B) and colonic (C-F) models
of inflammation. Hematoxylin/eosin (H/E) of C57BL/6 stomachs at eight weeks after
mock (A) or H. felis (B) infection. Notice the extensive inflammation seen after
infection. FVB/N (C) and FVB.mdr1a-/- (D) colons at 5 months of age. Note the increase
in inflammation in panel D. H&E stains of colons from B6.Rag-1-/- recipients of CD4+ T
cells from uninfected B6 mice reveals normal colonic architecture in uninfected
recipients (E), but severe inflammation in H. hepaticus-infected recipients (F). mRNA
expression of CXCL15 in each inflammation model (G). Each model is normalized to the
CXCL15 expression in the non-inflamed control. The H. felis infection for 8 weeks
increased the expression of CXCL15, whereas CXCL15 expression was decreased in
both the spontaneous and the infectious model of colonic inflammation (n = 3). Bar = 50
m.
37
Figure 5: The expression of ELR+ CXC chemokines in select tissues of the
gastrointestinal tract. (A) Gastric expression of ELR+CXC chemokines in mice infected
for 8 weeks with H. felis. The expression at one represents the expression of each
chemokine in the mock-infected animals. (B) Colonic expression in the FVB.mdr1a-/model of the ELR+CXC chemokines. The expression at one represents the expression of
each chemokine as compared to non-colitic FVB. n = 3 animals.
38
members of the murine ELR+ CXC chemokine family: KC, LIX, and MIP2. As can be
seen in Figure 5A, gastric expression of only two of these ELR+ CXC chemokines,
CXCL15 and LIX, is increased in C57BL/6 mice infected with H. felis for eight weeks,
as compared to the expression levels in mock-infected animals. Additionally, mdr1a-/mice on the FVB background develop severe colitis and have increased colonic
expression of MIP-2, LIX, and KC without an increase in CXCL15 as can be seen in
Figure 5B. All three models of inflammation have a significant component of
neutrophils in the inflammatory infiltrate (Supplementary Figure 2). As CXCL15 is not
increased in the two models of colitis, but is increased in the gastritis model, it is unclear
if it plays any role in this neutrophil chemotaxis.
39
DISCUSSION
Our findings clearly demonstrate that CXCL15 expression, at both the mRNA and
protein level, is not restricted to the adult lung. The original report of CXCL15
expression analyzed its expression in tissues by Northern Blot. In a paper by Mocharla et
al. it was shown that reverse transcriptase PCR is approximately 1000 fold more sensitive
than northern blot (29). Our qRT-PCR data indicate that the level of expression in all
tissues, with the exception of the adrenal gland, is approximately 1000-fold less than the
extremely high levels seen in the lung, therefore accounting for the “lack of expression”
previously determined using northern blot analysis. It should be noted that Mocharla and
coworkers did not analyze CXCL15 expression from many of the tissues investigated in
the current study. mRNA was isolated from the tissues reported in the original Northern
Blot, and in agreement with their findings, no expression was seen. Because our
demonstration of CXCL15 expression in multiple mucosal and glandular tissues of the
C57BL/6J mouse was different than expression reported in the original reports showing
limited expression of CXCL15 in the BALB/c murine lung, we tested several different
mouse strains (including Balb/cJ and FVB/N) to determine if the expression we observed
was strain specific. All strains showed similar patterns of expression, indicating that our
findings were not specific for the C57BL/6J strain. As the expression of CXCL15 in
mRNA and protein is not a direct one to one ratio, it appears that CXCL15 may be
regulated at both the RNA and protein level. Further studies will need to be preformed to
determine where the mechanisms of this regulation.
40
Although our results clearly demonstrated low level mRNA and protein
expression in multiple mucosal and endocrine tissues, they did not indicate what cell
type(s) were involved in producing CXCL15. Immunohistochemical experiments on
selected tissues clearly demonstrated expression in the epithelial layers of multiple organs
including the lung, trachea, colon, uterus, stomach, and small intestine (data not shown).
The function of CXCL15 at these epithelial surfaces would be expected to be similar to
its identified role in the lung, i.e. to induce neutrophil migration into sites of
inflammation and infection. As there are multiple differentiated epithelial cell types in
the stomach, we sought to determine which of these cell types expressed CXCL15.
Through the utilization of cell-specific expression markers, the transitional prezymogenic and the mature zymogenic cell were identified as the only cell types that
expressed CXCL15 in the stomach. Pre-zymogenic cells are a group of cells producing
secretory granules, which appear intermediate between the granules in mucus neck cells
and those of zymogenic cells. These cells eventually differentiate into mature zymogenic
cells; however, it is not clear how long cells spend in this transition phase (30). They
appear to share functions with zymogenic cells and mucus neck cells, i.e. the production
of mucus. The pre-zymogenic cells produce primarily pepsinogen, which is cleaved into
active pepsin by hydrochloric acid released by gastric parietal cells. This pepsin then
digests ingested food proteins. It is currently unclear what role CXCL15 would play in
this transitional cell type.
As CXCL15 is upregulated in response to multiple pulmonary inflammatory
stimuli, we postulated that CXCL15 expression might also be upregulated in
gastrointestinal inflammatory diseases. The most common cause of gastric inflammation
41
in humans is H. pylori infection (31); therefore we utilized a mouse model of
Helicobacter-induced gastritis to investigate this hypothesis. As predicted, CXCL15
expression was upregulated during experimental Helicobacter infection. The function of
CXCL15 in this model of inflammation could be to recruit neutrophils, as both human
and mouse Helicobacter-associated gastritis have a significant neutrophil infiltrate (32)
and Supplementary Figure 2. In addition, as this model of gastritis progresses over time
to gastric adenocarcinoma, it is intriguing to speculate that CXCL15 could also play a
role in this progression towards gastric epithelial cancer (33-35). One potential
mechanism for this involvement could be the role of CXCL15 as a chemoattractant for
bone marrow progenitor cells, as it has been recently reported that Helicobacterassociated gastric cancer originates from bone marrow stem cells (3, 36).
Contrary to what we saw in the H. felis-associated gastritis model, the expression
of CXCL15 was decreased in two models of murine colitis. As both models have mild to
moderate Gr-1+ neutrophil infiltrate, this implies that these neutrophils are recruited by
chemokines other than CXCL15 (19, 37) and Supplementary Figure 2. Our results imply
that CXCL15 does not play a significant role in either CD4-mediated infectious or
spontaneous murine colitis.
In order to investigate other potential mechanisms for neutrophil chemoattraction
in both the Helicobacter-associated gastritis and the spontaneous FVB.mdr1a-/- colitis
models, we decided to investigate the presence of other ELR+ CXC chemokines in the
gastrointestinal tract. Analysis of the 8-week infected H. felis gastritis model
demonstrated that expression of LIX and CXCL15 chemokines were increased.
Intriguingly, the pattern of inflammation-associated expression of ELR+ CXC
42
chemokines was different in the FVB.mdr1a-/- model, as expression of KC, LIX, and
MIP2 was increased, while CXCL15 expression was decreased.
In conclusion, CXCL15 (lungkine) can no longer be considered a lung-specific
chemokine. The low level expression in multiple mucosal tissues implies a much broader
role in inflammatory disease than just localized pulmonary inflammation. The
localization of CXCL15 to epithelial cells implies that part of its function could be to
sense external infection and initiate immune responses. However the actual functional
role of CXCL15 in gastrointestinal disease remains to be elucidated.
43
ACKNOWLEDGEMENTS
This work was supported in part by American Cancer Society Grant RPG-99-08601-MBC, the NIH grants R01 DK059911, P01 DK071176, and the University of
Alabama at Birmingham Digestive Diseases Research Development Center Grant #P30
DK064400. JMS received salary support from the NIH training grant T32 AI07041.
We would like to thank Camalla Kimbrough and Andrea Stanus for expert technical
assistance.
44
REFERENCES
1.
Barnes, P. J. 2003. Cytokine-directed therapies for the treatment of chronic
airway diseases. Cytokine Growth Factor Rev 14:511.
2.
Rossi, D. L., S. D. Hurst, Y. Xu, W. Wang, S. Menon, R. L. Coffman, and A.
Zlotnik. 1999. Lungkine, a novel CXC chemokine, specifically expressed by
lung bronchoepithelial cells. J Immunol 162:5490.
3.
Ohneda, O., K. Ohneda, H. Nomiyama, Z. Zheng, S. A. Gold, F. Arai, T.
Miyamoto, B. E. Taillon, R. A. McIndoe, R. A. Shimkets, D. A. Lewin, T.
Suda, and L. A. Lasky. 2000. WECHE: a novel hematopoietic regulatory
factor. Immunity 12:141.
4.
Chen, S. C., B. Mehrad, J. C. Deng, G. Vassileva, D. J. Manfra, D. N. Cook,
M. T. Wiekowski, A. Zlotnik, T. J. Standiford, and S. A. Lira. 2001.
Impaired pulmonary host defense in mice lacking expression of the CXC
chemokine lungkine. J Immunol 166:3362.
5.
Frederick, M. J., and G. L. Clayman. 2001. Chemokines in cancer. Expert
Rev Mol Med 2001:1.
6.
Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system
and their role in immunity. Immunity 12:121.
7.
Strieter, R. M., M. D. Burdick, J. Mestas, B. Gomperts, M. P. Keane, and J.
A. Belperio. 2006. Cancer CXC chemokine networks and tumour
angiogenesis. Eur J Cancer 42:768.
8.
Moepps, B., E. Nuesseler, M. Braun, and P. Gierschik. 2006. A homolog of
the human chemokine receptor CXCR1 is expressed in the mouse. Mol
Immunol 43:897.
9.
Maheshwari, A., R. D. Christensen, D. A. Calhoun, R. A. Dimmitt, and A.
Lacson. 2004. Circulating CXC-chemokine concentrations in a murine
intestinal ischemia-reperfusion model. Fetal Pediatr Pathol 23:145.
10.
Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal
Biochem 162:156.
11.
Bas, A., G. Forsberg, S. Hammarstrom, and M. L. Hammarstrom. 2004.
Utility of the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde3-phosphate-dehydrogenase for normalization in real-time quantitative
45
reverse transcriptase-polymerase chain reaction analysis of gene expression
in human T lymphocytes. Scand J Immunol 59:566.
12.
Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time
quantitative PCR. Genome Res 6:986.
13.
McLoughlin, R. M., R. M. Solinga, J. Rich, K. J. Zaleski, J. L. Cocchiaro, A.
Risley, A. O. Tzianabos, and J. C. Lee. 2006. CD4+ T cells and CXC
chemokines modulate the pathogenesis of Staphylococcus aureus wound
infections. Proc Natl Acad Sci U S A 103:10408.
14.
Brown, J. K., A. D. Pemberton, S. H. Wright, and H. R. Miller. 2004.
Primary antibody-Fab fragment complexes: a flexible alternative to
traditional direct and indirect immunolabeling techniques. J Histochem
Cytochem 52:1219.
15.
Burry, R. W. 2000. Specificity controls for immunocytochemical methods. J
Histochem Cytochem 48:163.
16.
Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular
immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490.
17.
Kullberg, M. C., D. Jankovic, P. L. Gorelick, P. Caspar, J. J. Letterio, A. W.
Cheever, and A. Sher. 2002. Bacteria-triggered CD4(+) T regulatory cells
suppress Helicobacter hepaticus-induced colitis. J Exp Med 196:505.
18.
Burich, A., R. Hershberg, K. Waggie, W. Zeng, T. Brabb, G. Westrich, J. L.
Viney, and L. Maggio-Price. 2001. Helicobacter-induced inflammatory bowel
disease in IL-10- and T cell-deficient mice. Am J Physiol Gastrointest Liver
Physiol 281:G764.
19.
Panwala, C. M., J. C. Jones, and J. L. Viney. 1998. A novel model of
inflammatory bowel disease: mice deficient for the multiple drug resistance
gene, mdr1a, spontaneously develop colitis. J Immunol 161:5733.
20.
Lorenz, R. G., and J. I. Gordon. 1993. Use of transgenic mice to study
regulation of gene expression in the parietal cell lineage of gastric units. J
Biol Chem 268:26559.
21.
Ito, S. 1987. Functional Gastric Morphology. In Physiology of the
Gastrointestinal Tract, p. 817.
22.
McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter
felis model of adoptive transfer gastritis. Immunol Res 33:183.
46
23.
Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005.
Helicobacter felis eradication restores normal architecture and inhibits
gastric cancer progression in C57BL/6 mice. Gastroenterology 128:1937.
24.
Elson, C. O., Y. Cong, V. J. McCracken, R. A. Dimmitt, R. G. Lorenz, and C.
T. Weaver. 2005. Experimental models of inflammatory bowel disease reveal
innate, adaptive, and regulatory mechanisms of host dialogue with the
microbiota. Immunol Rev 206:260.
25.
Stephens, R. H., J. Tanianis-Hughes, N. B. Higgs, M. Humphrey, and G.
Warhurst. 2002. Region-dependent modulation of intestinal permeability by
drug efflux transporters: in vitro studies in mdr1a(-/-) mouse intestine. J
Pharmacol Exp Ther 303:1095.
26.
Powrie, F., M. W. Leach, S. Mauze, S. Menon, L. B. Caddle, and R. L.
Coffman. 1994. Inhibition of Th1 responses prevents inflammatory bowel
disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity
1:553.
27.
Asseman, C., S. Mauze, M. W. Leach, R. L. Coffman, and F. Powrie. 1999.
An essential role for interleukin 10 in the function of regulatory T cells that
inhibit intestinal inflammation. J Exp Med 190:995.
28.
Mudter, J., S. Wirtz, P. R. Galle, and M. F. Neurath. 2002. A new model of
chronic colitis in SCID mice induced by adoptive transfer of CD62L+ CD4+
T cells: insights into the regulatory role of interleukin-6 on apoptosis.
Pathobiology 70:170.
29.
Mocharla, H., R. Mocharla, and M. E. Hodes. 1990. Coupled reverse
transcription-polymerase chain reaction (RT-PCR) as a sensitive and rapid
method for isozyme genotyping. Gene 93:271.
30.
Karam, S. M. 1999. Lineage commitment and maturation of epithelial cells in
the gut. Front Biosci 4:D286.
31.
Kusters, J. G., A. H. van Vliet, and E. J. Kuipers. 2006. Pathogenesis of
Helicobacter pylori infection. Clin Microbiol Rev 19:449.
32.
Dundon, W. G., H. Nishioka, A. Polenghi, E. Papinutto, G. Zanotti, P.
Montemurro, G. G. Del, R. Rappuoli, and C. Montecucco. 2002. The
neutrophil-activating protein of Helicobacter pylori. Int J Med Microbiol
291:545.
33.
Nomura, S., T. Baxter, H. Yamaguchi, C. Leys, A. B. Vartapetian, J. G. Fox,
J. R. Lee, T. C. Wang, and J. R. Goldenring. 2004. Spasmolytic polypeptide
47
expressing metaplasia to preneoplasia in H. felis-infected mice.
Gastroenterology 127:582.
34.
Cahill, R. J., C. Kilgallen, S. Beattie, H. Hamilton, and C. O'Morain. 1996.
Gastric epithelial cell kinetics in the progression from normal mucosa to
gastric carcinoma. Gut 38:177.
35.
Lynch, D. A., N. P. Mapstone, A. M. Clarke, G. M. Sobala, P. Jackson, L.
Morrison, M. F. Dixon, P. Quirke, and A. T. Axon. 1995. Cell proliferation in
Helicobacter pylori associated gastritis and the effect of eradication therapy.
Gut 36:346.
36.
Houghton, J., C. Stoicov, S. Nomura, A. B. Rogers, J. Carlson, H. Li, X. Cai,
J. G. Fox, J. R. Goldenring, and T. C. Wang. 2004. Gastric cancer
originating from bone marrow-derived cells. Science 306:1568.
37.
Li, X., J. G. Fox, M. T. Whary, L. Yan, B. Shames, and Z. Zhao. 1998.
SCID/NCr mice naturally infected with Helicobacter hepaticus develop
progressive hepatitis, proliferative typhlitis, and colitis. Infect Immun
66:5477.
48
Supplementary Figure 1: Expression of CXCL15 (green) was evaluated by
immunofluorescence in the three inflamed models of inflammation. The expression
pattern in a mock stomach (A) and H. felis-infected stomach after eight weeks (B). Notice
the increase of CXCL15 in the gastritis model. Figure 1C – F show CXCL15 expression
in the colitis models. Figure 1C shows the expression in the FVB/N mouse colon and (D)
shows the expression in the FVB.mdr1a-/- colon at 5 months of age. The last two panels
are colons from uninfected B6.Rag-1-/- recipients (E) or H. hepaticus infected B6.Rag-1-/recipients (F) of CD4+ T cells from uninfected B6 mice. Note the slight decrease in
CXCL15 expression in panel D and F. Bar = 50 m.
49
Supplementary Figure 2: Immunofluorescent analysis of neutrophils in the gastritis and
colitis models. A biotinylated rat-anti-mouse Gr-1 (Ly-6G) (clone RB6-8C5; BD
Pharmingen, San Diego, CA; 0.1 g/mL) was used to detect neutrophils. Visualization
was by Streptavidin-HPR and Cy3-Tyramide. Figures 2 A and B show the expression of
neutrophils in a mock-infected stomach (A) and a H. felis-infected stomach after eight
weeks (B). Note the absence of neutrophils in panel A but an increase once the stomach
becomes inflamed as seen in panel B. FVB/N (C) and FVB.mdr1a-/- (D) colons showing
the staining for neutrophils. Again notice the absence of neutrophils in the non-inflamed
but the infiltration of neutrophils in the inflamed model. The last two panels show the
expression of neutrophils in the uninfected B6.Rag-1-/- recipients (E) or H. hepaticus
infected B6.Rag-1-/- recipients (F) of CD4+ T cells from uninfected B6 mice. Again
notice the absence of neutrophils in the non-inflamed colon but an increase in the
inflamed colon. Bar = 50 m.
50
ROLE OF ADAPTIVE IMMUNITY IN MUCUS ALTERATIONS ASSOCIATED
WITH GASTRIC HELICOBACTER INFECTION
by
JULIA M. SCHMITZ, ROBIN G. LORENZ
In preparation for Journal of Histochemistry and Cytochemistry
Format adapted for dissertation
51
Abstract
Mucins and trefoil factors interact to form the protective mucus covering of the
stomach in mice and humans. During the histological progression from a normal human
gastric mucosa to gastric adenocarcinoma, multiple changes are seen in both the
epithelium as well as the mucus layer. The C57BL/6 mouse model has been shown to
progress from normal mucosa to gastric adenocarcinoma after H. felis infection.
Therefore, we utilized this model to analyze the epithelial expression of the mucins and
trefoil factors during disease progression by both qRT-PCR and immunofluorescence.
The mouse model of disease mimics many of the mucin changes seen in human infection,
including increases in Muc4, Muc5b, and decreases in TFF1. Contrary to the human
disease, Muc5ac expression appeared unchanged by RNA expression. However, when
analysis was done by immunofluorescene to determine the pattern and location of
expression after infection, a significant decrease in expression in the body of the stomach
was evident as early as 4 weeks after infection. This loss was prior to the development of
significant metaplasia or dysplasia. This decrease in Muc5ac expression does not appear
to be a result of the adaptive immune response as similar changes in expression were see
after infection of B6.Rag-/- mice, which lack B and T cells. Intriguingly, the increases in
Muc4 and Muc5b were not seen in infected B6.Rag-/- mice, indicating a clear role for
adaptive immunity in these mucin alterations.
52
Introduction
Gastric Cancer is the second leading cause of cancer death worldwide and is
associated with Helicobacter pylori infection (Parkin et al. 2005; Vanagunas 1998).
Based on the Laurén System, there are two types of gastric adenocarcinoma – diffuse and
intestinal (Lauren 1965). The diffuse type is characterized by a poorly differentiated
epithelium and has transmural invasion with lymphatic spread. It is more commonly seen
in younger people and affects women more than men. The intestinal type is more
common with increasing age and in males. It is associated with environmental
exposures, including H. pylori infection and diets high in nitrates, and has been proposed
to develop in a stepwise progression from normal gastric epithelium to gastritis, atrophy,
intestinal metaplasia, dysplasia, and finally adenocarcinoma (Correa 1988). The initial
gastritis is a development of both active (neutrophils) and chronic (monocytes and
lymphocytes) inflammation in the stomach that is triggered by the gastric Helicobacter
infection. This is often followed by gastric atrophy where the specialized cells, such as
parietal and zymogenic cells, are lost resulting in an increased pH in the stomach. In a
small number of susceptible patients, this is followed by intestinal metaplasia, which is
marked by decreases in gastric mucin expression and increases in intestinal mucins. The
final stage prior to adenocarcinoma development is dysplasia, which is marked by
abnormal growth or development of cells. Early gastric adenocarcinomas are confined to
the gastric mucosa and submucosa, while advanced cancers extend into the muscle wall
(Fox et al. 1993; Leung and Sung 2002). The C57BL/6 mouse model of disease utilizes
the closely related gastric Helicobacter, H. felis, to initiate gastritis and subsequent
53
gastric pathology (Lee et al. 1990; McCracken et al. 2005; Mohammadi et al. 1996). Cai,
et.al. have reported that in C57BL/6 mice infected for 15 months, 100% of infected mice
have progressed to gastric adenocarcinoma (Cai et al. 2005).
One of the hallmarks of human gastric adenocarcinoma is the alterations in the
types of mucins expressed, from gastric mucins to intestinal-type mucins (Correa 1988).
Mucus, a gel-like substance that covers the mammalian epithelial surfaces of tissues, is
composed of mucin glycoproteins and trefoil factors (TFF) (Chen et al. 2004; Kaneko et
al. 2003). Mucus acts as both a lubricant and also as a protective barrier between the
contents of the stomach and the mucosal epithelial surface (Shirazi et al. 2000). In
humans, twenty-one mucins have been identified in tissues such as lung, nose, salivary
glands, and gastrointestinal tract (Chen et al. 2004; Higuchi et al. 2004). Seven mucins
have been identified in mice (Muc1, 2, 3, 4, 5ac, 5b, and 6) which are homologous to the
human mucins. Mucins consist of a protein backbone with many carbohydrate side chains
as well as tandem repeats of serine, theroine, and proline. The mucins are heavily
gylcosylated and they are thought to play a role in the bacterial colonization of the gastric
mucosa (de Bolos et al. 2001). There are two types of mucins – membrane bound (Muc1,
3, and 4) and secreted (Muc2, 5ac, 5b, and 6) (Kawakubo et al. 2004; Ringel and Lohr
2003). The secreted mucins are conserved between the human and mouse forms (Escande
et al. 2004). In normal human gastric mucosa, MUC1 and MUC5AC are expressed in the
superficial epithelium, while MUC6 is localized to the deep glands and the mucus neck
cells. MUC2, MUC3, MUC4, and MUC5B are not normally expressed in the human
gastric mucosa (Babu et al. 2006; Ho et al. 1995; Pinto-de-Sousa et al. 2004).
54
In humans and mice there are three trefoil factors: TFF1/pS2, TFF2/spasmolytic
polypeptide (SP), and TFF3/intestinal trefoil factor (ITF). Trefoil factors are small,
soluble peptides with trefoil or P domains. The trefoil domains are made up of six
cysteines residues (Hoffmann and Hauser 1993; Katoh 2003). Trefoil factors are secreted
from the granules in the mucus secreting cells (Clyne et al. 2004). Trefoil peptides act as
scaffolding for the mucins within the stomach, with specific TFFs cross linking with
mucins to help form the gel layer in the stomach (Clyne et al. 2004; Shirazi et al. 2000).
TFF1 is normally found in the superficial cells of the body and antral mucosa of the
stomach, while TFF2 is found in the mucus neck cells of the body and antral glands in the
stomach. TFF3 is normally not expressed in the stomach, but is expressed in the intestine
and the salivary glands (Wong et al. 1999). Previous studies in humans showed that
TFF1 interacts with MUC5AC, TFF2 interacts with MUC6, and TFF3 interacts with
MUC2 (Clyne et al. 2004; Ruchaud-Sparagano et al. 2004).
Changes have been seen in the expression of mucins and TFFs in gastric
adenocarcinoma. MUC1 has been shown to be expressed early in the infection process
but is decreased during the metaplastic stage (Wang and Fang 2003). MUC2, MUC3,
MUC4, MUC5B, and TFF3 are not expressed in the normal human stomach, but are
expressed in gastric adenocarcinoma biopsies. This contrasts with MUC5AC, which is
expressed in a normal stomach but not in gastric adenocarcinoma (Dhar et al. 2005; Ho et
al. 1995; Marques et al. 2005; Pinto-de-Sousa et al. 2004; Roessler et al. 2005; Wang and
Fang 2003). MUC6 is expressed at high levels in a normal human stomach in the mucus
neck cells and the antrum but is absent in gastric epithelium altered by gastric cancer (Ho
et al. 1995; Pinto-de-Sousa et al. 2004). TFF1 has been shown to be lost in 50% of gastric
55
carcinomas (Muller and Borchard 1993; Wong et al. 1999). TFF2 expression was
detected by immunohistochemistry in human stomach biopsies demonstrating gastritis
and atrophy but not during intestinal metaplasia and gastric carcinoma (Hu et al. 2003).
TFF3 is found in the stomach as it progresses through the intestinal metaplasia stage and
is conserved in gastric cancer (Taupin et al. 2001). In the aforementioned studies MUC1,
MUC2, and MUC6 expression was characterized by both RNA expression and
immunohistochemistry staining. MUC3 and MUC4 expression was characterized by
RNA. MUC5AC, MUC5B, TFF1, TFF2, and TFF3 were characterized only by
immunohistochemistry.
Previous studies have shown that H. pylori will bind to both Muc5ac and TFF1 in
the stomach, both of which have decreased expression during the progression to gastric
adenocarcinoma (Clyne et al. 2004; Van De Bovenkamp et al. 2005; Van den Brink et al.
2000). As the H. felis infected C56BL/6 model of disease is now widely utilized to study
the mechanisms of cancer development, we initiated experiments to determine how
closely this mimics the human pathology. Previous studies have concentrated on the
expression of trefoil factors, specifically TFF1 and TFF2, in the mouse model, but there
has been no comprehensive analysis of all the murine mucins and TFFs over the course
of the disease (Kurt-Jones et al. 2007; Nomura et al. 2004). TFF2-/- mice have been
infected with H. felis and shown to have an increased susceptibility to H. felis gastritis
(Kurt-Jones et al. 2007). Another study infected TFF2-/- with H. pylori (SS1) and showed
increased IFN in the mice suggesting a protective role for TFF2 by moderating the
levels of IFN (Fox et al. 2007). It is also thought that spasmolytic peptide expressing
metaplasia (SPEM) a lineage of TFF2 could be a marker for dysplasia in cancer as it was
56
detected by immunohistochemistry and DNA microarrays analysis of gastric biopsies
(Nomura et al. 2004). Glycoproteins, which contain mucins, are found on the surfaces of
cancer cells. In gastrointestinal tumors the glycoproteins have been found to be altered in
expression and could have an impact on the immune response and cell adhesion during
the disease (Brockhausen 2003). Therefore, we investigated the alterations in gastric
mucins and trefoil factors as the murine disease progresses from gastritis through
dysplasia and metaplasia to gastric carcinoma by both immunohistochemistry and RNA
expression.
57
Materials and Methods
Murine model of H. felis infection
C57BL/6 and C57BL/6J-Rag-1tm1Mom (B6.Rag-1-/-) strains between 6 and 10
weeks of age at the time of initial infection were fed autoclaved rodent chow (NIH-31,
Harlan Teklad, Madison, WI) and water ad lib and maintained on a 12:12-hr light-dark
schedule. Animal procedures and protocols were conducted in accordance with the
Institution Animal Care and Use Committee at the University of Alabama at Birmingham
(Birmingham, AL). Mice were mock-infected or infected with H. felis as described
previously (Roth et al. 1999). Briefly, the mice were infected by oral gavage three times
over a seven-day period with 5 X 107 CFU H. felis (ATCC 49179). This results in a
~100% infection efficiency in our laboratory. The mock-infected mice were infected with
the sterile BHI/glycerol mixture without the bacteria.
Tissue Preparation
The mice were sacrificed using isofluorane inhalation followed by cervical
dislocation. Immediately after sacrifice the tissues were removed and divided, with one
half quick frozen in liquid nitrogen for total RNA isolation and the other half immersion
fixed in Carnoy‟s solution (6:3:1 of 100% ethanol, chloroform, and glacial acetic acid)
for immunohistochemistry. The tissue was fixed for 4 hours at 4oC, and then changed to
an ethanol wash for 18-24 hours prior to paraffin embedding. Five-micron sections were
cut on a microtome and attached to pre-cleaned microscope slices (Snowcoat X-tra,
Surgipath; Richmond, IL).
58
Total RNA was isolated by the phenol and guanidine isothiocyanate method using
Trizol® (Invitrogen; Carlsbad, CA)(Chomczynski and Sacchi 1987). Genomic DNA was
removed from the extracted total RNA using the Turbo DNase kit (Ambion, Austin, TX).
cDNA was made with equal amounts of mRNA (2 g), using the Transcriptor First
Strand cDNA Synthesis Kit (Roche, Pensberg, Germany). Quantitative real-time reverse
transcription polymerase chain reaction (qRT-PCR) was performed on the samples using
Applied Biosystems Assays-On-Demand primer/probe sets and TaqMan Universal PCR
Mix (Pe Applied Biosystems, Foster City, CA). The samples were analyzed on the
Stratagene MX3000P real-time PCR Machine. See Table 1 for Applied Biosystems
Assays-On-Demand primer/probe sets that were used. The fold change was determined as
described in the Applied Biosystems manufactor‟s instructions (4371095 Rev A, PE
Applied Biosystems, Foster City, CA). Briefly, the average crossing threshold of each
housekeeping gene (18S) minus the average crossing threshold of each target gene to
determine the relative expression (CT). The average CT of the experimental animals
(Helicobacter-infected) is subtracted from the average control (mock-infected) Ct to
determine the CT. The Ct is then used in the formula 2Ct to determine the fold
change in mRNA expression. The upper and lower limits of fold change were determined
by taking the averaged standard deviations of each experimental group taken through the
above calculations (Bas et al. 2004; Heid et al. 1996).
59
Table I: Primer-Probe pairs utilized for qRT-PCR
Gene
Applied Biosystems
Exons detected Gene ID
Catalogue Number*
by Probe
18S – housekeeping Hs99999901_s1
none
X03205
gene
Muc1
Mm00449604_m1
6–7
Mm.16193
Muc2
Mm00458299_m1
7–8
Mm.2041
Muc3
Mm01207056_m1
None
Mm.7184
Muc4
Mm00466886_m1
7–8
Mm.214599
Muc5ac
Mm01276725_g1
33 – 34
Mm.334332
Muc5b
Mm00466376_m1
1–2
Mm.200752
Muc6
Mm00725165_m1
None
NM_181729.1
TFF1
Mm00436945_m1
1–2
Mm.2854
TFF2
Mm00447491_m1
2–3
Mm.1825
TFF3
Mm00495590_m1
2–3
Mm.4641
*All genes were purchased from Applied Biosystems (Foster City, CA).
60
Histological and Immunofluorescent Scoring Systems
All histological and immunofluorescent scores are determined by two observers
blind to the experimental groups (RGL and JMS). Tissue sections were stained with
hematoxin and eosin for histological analysis. The scoring system is a 0 to 9 scale (0 - no
inflammation or epithelial changes; 9 – severe inflammation and extensive epithelial
abnormalities) with subscores of 0 to 3 in each of the following three areas: longitudinal
extent of inflammation, vertical extent of inflammation, and histological changes. Gastric
cancer is determined histologically by an invasion of infiltrates through the muscularis
layer. The scores are averaged between the blind scorers and graphed individually with
the horizontal line indicating the median.
Tissue sections were stained with the rabbit polyclonal anti-Helicobacter pylori
antibody which cross reacts with H. felis (unpublished observation, SIG-3431; Convance,
Emeryville, CA). Briefly, sections are deparrafinized by successive immersions in
citrosolv (Fisher Scientific, Pittsburgh, PA) and isopropanol, and rehydrated with
phosphate buffered saline (PBS). The tissues were pretreated with 0.25% pepsin in PBS
for 10 minutes at r.t. and blocked with PBS-blocking buffer (1% bovine serum albumin
and 0.3% Triton) for fifteen minutes to block non-specific binding and to allow the
antibody access to cell surface and internal antigens. The slides were incubated with antiHelicobacter for one hour at r.t., (undiluted) washed in PBS, and incubated with Cy3
donkey anti-rabbit IgG (24 ng/mL; cat# 711-165-152; Jackson Immunoresearch, West
Grove, PA) for one hour. The sections were counterstained with Hoechst dye (1 ng/mL;
bis-benzimide, Cat# B2883, Sigma, St. Louis, MO) to visualize nuclei. Colonization is
61
scored in a semi-quantitative system, with a range of 0 to 4; where 0 = no bacteria per
crypt, 1 = 1 – 2 bacteria per crypt, 2 = 3 – 10 bacteria per crypt, 3 = 11 – 20 bacteria per
crypt, and 4 = >20 bacteria per crypt. Two scores are obtained for each tissue – one at the
squamous-glandular epithelial junction and one from the antrum. The 2 scores for each
mouse per section are averaged together. When the scores are graphed both sections are
averaged together.
Mucin and Trefoil Factor Immunofluorescence
All slides were taken through the deparrafinzation steps as described earlier.
Slides stained for Muc3, Muc4, and TFF1 were taken through an avidin and biotin block
(cat#SP-2001; Vector Laboratories, Burlingame, CA) each for 15 minutes with a PBS
wash in between. All stains required a 15 minute blocking step with PBS blocking buffer
(which consists of 1% BSA and 0.3% Triton X-100) to block nonspecifically binding
proteins and to provide access to the cell surface and antigens to the tissue. The slides
were then incubated over night with one of the following antibodies: rabbit polyclonal
anti-Muc1 (2 g/mL; cat#15481; Abcam, Cambridge, MA), chicken anti-mouse Muc3
synthetic peptide (1:200 dilution, HO29; kind gift of Dr. Samuel Ho, Minneapolis, MN)
rabbit anti-mouse Muc4 synthetic peptide (1:200 dilution, HO4-2; kind gift of Dr.
Samuel Ho) or goat polyclonal anti-TFF1/pS2 (2 g/mL; cat# sc-7843; Santa Cruz
Biotechnology; Santa Cruz, CA). Secondary detection for Muc1 used Cy3 donkey antirabbit IgG. All other antibodies went through an additional biotin labeling step: biotin
rabbit anti-chicken IgG (1:10,000; cat# 61-3140; Zymed, San Francisco, CA) for Muc3;
biotin donkey anti-rabbit IgG (1:1000; cat# 711-065-152; Jackson Immunoresearch, West
62
Grove, PA) for Muc4 and biotin mouse anti-goat IgM ( 13 g/mL, cat# 115-065-068;
Jackson Immunoresearch). Detection for these antibodies was with Cy3 Strepavidin (18
g/mL; cat# 016-106-084; Jackson Immunoresearch), followed by visualization nuclei of
by Hoechst dye.
Muc5ac immunofluorescene and evaluation
Muc5ac expression was evaluated in the gastric epithelium through the use of a
“mouse on mouse” protocol (Brown et al. 2004). Briefly the sections were
deparaffinized, rehydrated, and blocked as described above. Mouse monoclonal IgG1
anti-Muc5ac (clone 45M1; 200 g/mL, cat# MS-145-PO, Thermo Scientific, Fremont,
CA) and the Cy3 Fab goat anti-mouse secondary antibody (1.5 mg/mL; cat# 115-167003; Jackson Immunoresearch), were incubated together at a 1:2 ratio (w/w) in triton-free
PBS blocking buffer for 40 minutes at room temperature (RT). Unbound Fab fragments
were then bound with excess mouse serum at 1:100 final dilution for 10 minutes at room
temperature before placed on the slide for one hour. Visualization of the nuclei was by
Hoechst staining. The slides were score as described above, with the exception that the
scoring is on a 0 – 3 scale with 0 = no staining and 3 = maximal staining. Each stomach
section was scored in both the body and the antrum. The antrum scoring was used as an
internal positive control as we determined that H. felis infection in our model only alters
expression of Muc5ac in the body of the mouse stomach. Only slides that scored a 2 or 3
in the antrum were used for further analysis.
63
Microscope
All histological and fluorescent photomicrographs were taken using a automated
operated Zeiss® Axioskop 2 (Thornwood, NY) with an Axiocam® HRC camera. The
software utilized was Axiovision® Release 4.6.3 (Zeiss).
Graphic and Statistical Analysis
For the qRT-PCR, graphs were made of the calculated mean fold change using the
GraphPad Prism 4® (San Diego, CA). All the qRT-PCR graphs are horizontal with the yaxis set at one to represent the baseline expression of each gene for each animal for
comparison. The mean fold change and range are graphed. Statistics were performed on
all data using GraphPad InStat 3® (San Diego, CA) using an un-paired t-tests for
continuous data. Uncontinuous data statistics was performed using the Mann Whitney U
test. A p-value of <0.05 was considered significant.
64
RESULTS
H. felis infection of C57BL/6 mice results in chronic active gastritis and gastric
adenocarcinoma
To investigate the timing of progression to gastric adenocarcinoma, female
C57BL/6 mice were infected with H. felis and sacrificed at multiple time points over a
one-year period (4, 8, 12, 16, 20, 24 and 52 weeks). Over the one-year time course,
gastric inflammation and epithelial alterations are increased, with maximal histological
scores seen 16 weeks into the infection (Fig. 1A). These histological changes are
paralleled by a subsequent reduction in bacterial colonization, as is also reported in
human disease (Fig. 1B) (Karnes et al. 1991; Kikuchi 2002). Figure 1C – G shows the
representative histology at each time point (in comparison to a mock control). Figure 1C
is a B6 mock-infected stomach, showing evidence of the normal glandular organization
in the parietal zone of the murine stomach and no evidence of inflammation. The parietal
cells, which are responsible for the gastric acidity of the stomach, are indicated by the
arrows. Figure 1D is representative of gastritis in the mouse stomach, when the
inflammatory infiltrates are first evident; this is four weeks into the infection. The next
panel, 1E, is a stomach in atrophy, which occurs 12 – 16 weeks after the initial infection
in the mouse. At this stage the parietal cells are lost and the immune infiltrates are still
evident. Figure 1F is representative of a stomach in intestinal metaplasia, this usually
occurs late in the infection (stomach after 24 weeks). This is when the stomach mimics an
intestinal cellular structure especially with the appearance of the goblet cells. Figure 1G
is a representation of gastric adenocarcinoma (52 weeks) with invasion of the dysplastic
65
Hf Colonization Score
Histological Score
4
9
8
7
6
5
4
3
2
1
0
1
B6 mock B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf
8 wks 12 wks 16 wks 20 wks 24 wks 52 wks
A
D
4 wks 8 wks
B
Weeks
C
2
0
B6 m ock B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf B6 + Hf
4 wks
3
12 wks 16 wks 20 wks 24 wks 52 wks
Weeks
E
F
G
Figure 1: Disease progression during H. felis infection in C57BL/6 mice. Figure 1A
shows the histological scores of the B6 mouse over the course of the infection. 1B shows
the colonization score over the course of the infection. In these two graphs the horizontal
line represents the median score. The circles represent individual animals. Panels 1C
through G are histological pictures during the course of the infection. 1C is a mock
mouse showing the normal glandular structure of the stomach. 1D is a picture
representing a stomach during gastritis, taken after 4 weeks of infection. 1E represents a
stomach in gastric atrophy (16 weeks), followed by 1F which is a representation of
intestinal metaplasia (52 weeks). Panel 1G is a histological representation of a 52 week
infected stomach that has gastric adenocarcinoma as is indicated by the invasion of the
infiltrates through the muscularis.
66
glands through the muscularis. In our facility 58% of our mice progress to gastric
adenocarcinoma after 52 weeks of infection.
Gene expression of Mucins and TFFs are altered after H. felis infection
Quantitative real-time reverse transcriptase PCR (qRT-PCR) was performed on
total gastric RNA samples taken at multiple time points during the infection process to
determine the expression of mucins and TFFs. At each timepoint, the gene expression
level in mock-infected gastric RNA is assigned a fold change of 1. To determine that the
baseline expression of the mucins did not change over time, the fold change analysis was
done on the mocks from the different time points comparing back to the 4 week mock.
There was no significant change in the expression of the mock animals over the course of
the experiment (data not shown). Table 2 shows the fold change and range for each
mucin and TFFs over the course of the infection. Figure 2 shows several examples of
trends in mucin gene expression over the course of the infection. Muc1 is shown in
Figure 2A and represents the large number of mucins that showed no significant change
in expression after H. felis infection as compared to the mock-infected stomachs. Other
mucins and TFFs with this gene expression pattern were Muc2, Muc6, TFF1, and TFF2
(Table 2). The expression of Muc3 decreased over the course of infection (Fig. 2B), a
pattern that was also seen with TFF3 (Table 2). Fig. 1C demonstrates an increase in
Muc4 over the course of the infection especially at 20 and 24 weeks. This pattern is seen
with Muc5b (Table 2). Surprisingly, the expression of Muc5ac by qRT-PCR in the total
gastric RNA was unchanged (Fig. 2D). As immunohistochemical expression of this
67
Table II: Average Fold Change and +/- Range of Mucin Genes
4 weeks
8 weeks
12 weeks 16 weeks
1.22
2.45
2.66
0.628
Muc1
(0.246 –
(0.259 –
(1.52 –
(0.0665 –
6.1)
23.197)
4.68)
5.93)
0.189
3.22
2.109
0.217
Muc2
(0.017 –
(0.38 –
(0.643 –
(0.014 –
2.069)
27.4)
6.92)
3.43)
0.311
2.73
2.46
0.161
Muc3
(0.04 –
(0.232 –
(1.357 – (0.00569 –
2.45)
32.02)
4.448)
4.58)
0.576
0.0213
4.6375
7.5
Muc4
(0.048 – (0.00224 – (1.835 –
(0.586 –
6.85)
0.2017)
11.723)
95.88)
0.0962
2.78
0.436
0.354
Muc5ac
(0.0058 –
(0.501 –
(0.0593 –
(0.022 –
1.58)
15.45)
3.201)
5.71)
8.23
1.756
6.301
0.857
Muc5b
(0.782 –
(0.136 –
(4.002 –
(0.094 –
86.76)
22.61)
9.92)
7.82)
0.317
4.37
3.094
0.857
Muc6
(0.0378 –
(0.586 –
(1.131 –
(0.094 –
2.66)
32.597)
8.46)
7.82)
0.24
2.72
0.76
0.643
TFF1
(0.032 –
(0.356 –
(0.206 –
(0.0617 –
1.75)
20.81)
2.8)
6.71)
1.79
4.672
1.18
0.534
TFF2
(0.322 –
(0.641 –
(0.472 –
(0.0564 –
9.9)
34.056)
2.97)
5.049)
0.71
2.45
1.156
0.292
TFF3
(0.0867 –
(0.34 –
(0.424 –
(0.022 –
5.82)
17.67)
3.15)
3.84)
68
20 weeks
2.021
(0.5439 –
7.51)
0.471
(0.164 –
1.359)
0.0262
(0.0077 –
0.0898)
15.63
(2.53 –
96.88)
0.999
()0.274 –
3.65)
15.242
(2.957 –
78.56)
0.5
(0.18 –
1.38)
1.05
(0.321 –
3.43)
0.8497
(0.361 –
2)
0.37
(0.166 –
0.844)
24 weeks
1.18
(0.276 –
5.05)
1.615
(0.3789 –
6.89)
0.254
(0.076 –
0.85)
23.05
(3.98 –
133.52)
0.868
(0.23 –
3.32)
6.22
(0.847 –
45.71)
3.46
(0.66 –
18.17)
0.466
(1.12 –
1.463)
1.682
(0.469 –
6.03)
0.1667
(0.046 –
0.901)
Muc1
Muc3
4 w eeks
8 w eeks
8 w eeks
12 w e e k s
12 w e e k s
16 w e e k s
16 w e e k s
20 w e e k s
20 w e e k s
24 w e e k s
24 w e e k s
4.9×10 -04
9.8×10 -04
2.0×10 -03
3.9×10 -03
7.8×10 -03
0.015616
0.031232
0.06246
0.1249
0.25
0.5
1
2
4
8
16
32
64
127.9
255.9
4.9×10 -04
9.8×10 -04
2.0×10 -03
3.9×10 -03
7.8×10 -03
0.015616
0.031232
0.06246
0.1249
0.25
0.5
1
2
4
8
16
32
64
127.9
255.9
4 w eeks
A
Fold Change
B
Muc4
Fold Change
Muc5ac
4 w eeks
4 w eeks
8 w eeks
8 w eeks
12 w e e k s
12 w e e k s
20 w e e k s
20 w e e k s
24 w e e k s
24 w e e k s
C
Fold Change
4.9×10 -04
9.8×10 -04
2.0×10 -03
3.9×10 -03
7.8×10 -03
0.015616
0.031232
0.06246
0.1249
0.25
0.5
1
2
4
8
16
32
64
127.9
255.9
16 w e e k s
4.9×10 -04
9.8×10 -04
2.0×10 -03
3.9×10 -03
7.8×10 -03
0.015616
0.031232
0.06246
0.1249
0.25
0.5
1
2
4
8
16
32
64
127.9
255.9
16 w e e k s
Fold Change
D
Figure 2: RNA expression of mucins over the course of infection. Panel 2A shows muc1
expression. Panel 2B shows the expression of muc3. Panel 2C shows the expression of
muc4 over the course of the infection. Panel 2D shows the expression of muc5ac over the
course of the infection. All infected animals are compared to their respective mockinfected controls at the same time points. The y-axis is set at one to represent the baseline
expression in mock-infected controls. The mean and range for each time point is graphed.
69
mucin has been shown to be almost completely lost in human biopsies, we extended our
investigations to include histological analysis of gastric expression of murine mucins.
Mucin glycoprotein expression after H. felis infection
As the majority of reports investigating mucin and TFF alterations in human
gastric pathology focus on glycoprotein expression by immunohistochemisty, we
evaluated the expression of selected mucins in our murine model of Helicobacterassociated gastric dysplasia and adenocarcinoma. By immunohistochemical analysis
there was no change in the expression of Muc1 at 16 weeks, a finding consistent with the
gene expression analysis (Fig. 3A, E). Immunohistochemical analysis of Muc3
expression in the mock (Fig. 3B) and 16 weeks infected stomach (Fig 3F) also showed no
significant differences, however this contrasts with the gene expression data, which
indicated a slight decrease in expression at later time points. There is a clear increase in
the immunohistochemical expression of Muc4 (Fig. 3C, G) after 16 weeks of H. felis
infection. This correlates with the RNA expression shown in Fig. 2. There is an almost
complete loss of Muc5ac expression in the body of the 16 weeks H. felis infected
stomach (Fig. 3D, H), which correlates with the lack of expression seen in human
adenocarcinoma biopsies, but does not correlate with our RNA expression data. One
potential explanation for this discrepancy is that Muc5ac expression is maintained in the
antrum of mice infected with H. felis (data not shown). As our RNA expression data is
for the total stomach, the technique may not be sensitive enough to pick-up this regionspecific loss of mucin expression.
70
A
B
C
D
E
F
G
H
Figure 3: Immunofluorescent analysis of mucins over the course of infection. Panel 3A
(mock) and E (Helicobacter infected) shows stomachs stained with Muc1; there is no
increase in the staining at 16 weeks. Panel 3B (mock) and F (Helicobacter infected) show
16 week B6 stomachs stained with Muc3 with no change in the staining. Panel C (mock)
and G (Helicobacter infected) are B6 stomachs stained for Muc4, after 16 weeks. There is
an increase in the staining in panel G. Panels D (mock) and H (Helicobacter infected) are
16 week B6 stomachs are stained for Muc5ac. There is a lost in the expression of Muc5ac
in panel H in the gastric body.
71
Association of muc5ac immunofluorescence with gastric pathology
MUC5AC is one of the main mucins whose expression is decreased in biopsies of
gastric adenocarcinoma (Babu et al. 2006; Ho et al. 1995; Reis et al. 1997). As our gene
expression data clearly did not correlate with immunohistochemical expression at 16
weeks (Fig. 3H), we further investigated the Muc5ac expression by immunofluorescence
at all post-infection time points. Our data indicated that Muc5ac was lost in the gastric
body as early as 4 weeks after infection, with complete loss seen by 16 weeks (Fig. 4).
This decreased glycoprotein expression correlates with gastritis, but occurs prior to
significant epithelial alterations such as atrophy, metaplasia, or dysplasia.
Role of innate immunity in mucin alterations seen after H. felis infection
We have previously shown that CD4+ T-cells are critical to the induction of
gastritis, metaplasia, and dysplasia, after H. felis infection of C57BL/6 mice (McCracken
et al. 2005; Roth et al. 1999). Therefore, we utilized a similar experimental system to
determine the contribution of the adaptive immune system to the alterations seen in
mucin and TFF expression after H. felis infection. As B6.RAG-1-/- mice are deficient in B
or T cells, they are a good model to use to analyze the effects of H. felis infection in the
absence of an adaptive immune system (Mombaerts et al. 1992). As previously
published, at 4 and 16-weeks after H. felis infection, the B6.RAG-1-/- mice showed no
significant histological alterations, while maintaining a high level of HF colonization
(data not shown). Intriguingly, these mice still lose Muc5ac expression in the body as
early as 4 weeks after H. felis expression, implying that the adaptive immune response is
not responsible for this expression change. However, the increased expression of two
72
Muc5ac Score
3
2
1
0
B6 m ock B6 + Hf
4 wks
B6 + Hf
B6 + Hf
*
*
B6 + Hf
B6 + Hf
B6 + Hf
8 wks 12 wks 16 wks 20 wks 24 wks
Weeks
Figure 4: Immunofluorescent expression of Muc5ac over the course of the infection.
Muc5ac was analyzed by a semiquantative scoring system on a 0 – 3 scale. The
individual scores are indicated by the circle with the horizontal line representing the
median. *p < 0.05 as compared to B6 mock.
73
Muc5ac Score
3
2
1
*
0
B6 m ock RAG m ock B6 + Hf
1 wk
*
*
RAG + Hf
B6 + Hf
RAG + Hf
B6 + Hf
RAG + Hf
1 wk
4 wks
4 wks
16 wks
16 wks
Weeks
muc3
muc4
*
B6
B6.RAG
muc5ac
muc5b
*
0.
12
0. 5
25
0.
5
1
2
4
8
16
32
64
12
8
25
6
51
10 2
2
20 4
4
40 8
96
TFF1
Fold Change (16 weeks)
Figure 5: Comparison of mucin expression in C56BL/6 and B6.RAG-1-/- infected mice.
Figure 5A is the immunofluorescence expression of Muc5ac in the B6 and B6.RAG
animals over the course of the experiment. As there were no changes in the uninfected
animals they are all combined. *p < 0.01 as compared to respective mocks. Figure 5B
shows the RNA expression in the B6.RAG-1-/- and the B6 stomachs looking at 16 weeks
of infection. *p < 0.01 as compared to respective mocks.
74
mucins, Muc4 and Muc5b, was critically dependent on the presence of an adaptive
immune response. Figure 5B shows the RNA data between the B6 and B6.RAG. The
expression of Muc4 and Muc5b never changes in the infection in the B6.RAG-1-/- while
it changes in the B6 model.
75
DISCUSSION
Many publications have shown alterations in the expressions of mucins and trefoil
factors in human gastric atrophy and adenocarcinoma; however, it is unclear how our
murine model of disease correlates with this information. Since C57BL/6 infection with
H. felis resembles the human disease histologically, we designed experiments to examine
whether mucins and trefoil factor expression would be altered in a way that resembled the
human disease. The histological changes and the degree of H. felis colonization were
inversely proportional in our mouse model, similar to what is seen in the human disease
(Correa 1988; Karnes et al. 1991; Kikuchi 2002). As the histological scores increase
(indicating an increase in both inflammation and epithelial alterations) the colonization of
H. felis is decreased. Our RNA expression data demonstrates that Muc4, Muc5b, and
TFF1 resemble what has been seen in biopsies of human gastric adenocarcinoma. Muc1,
Muc2, Muc3, Muc5ac, TFF2, and TFF3 all had the same expression in total gastric RNA
regardless of the presence or timing of infection. Although this is different than what is
reported in human disease, there are at least three possible explanations. First, the mouse
disease may not mimic precisely what is seen in the human disease. Second, the mice
were analyzed at 24 weeks of infection (the longest time point used), and at this point the
majority of them have not progressed to gastric adenocarcinoma, whereas the human
literature analyzed biopsies from patients who have progressed to gastric
adenocarcinoma. Finally, it is clear that there is not a direct correlation between RNA
expression of mucin genes and their level of expression, as assess by
immunohistochemical detection with antibodies. As mucins are complex glycoproteins,
76
their antibody epitotes are almost certainly made up of both specific amino acid
sequences and the specific sugar residues attaches to this protein backbone (Brockhausen
2003; de Bolos et al. 2001). Our RNA expression data cannot evaluate any differences in
glycoprotein expression secondary to alterations in glycosylation. Therefore, where
murine-specific antibodies were available, we also evaluated the immunohistochemical
expression of mucins.
Table III correlates the changes seen in the H. felis C57BL/6 mouse model (using
24 weeks as the endpoint for comparison) as compared to the human model (based on
literature) of the disease. MUC4, MUC5B, MUC5AC, TFF1 and TFF2 appear to change
in similar manners in both models. MUC1 has similar expression in a normal gastric
stomach but differ when expression in human biopsies are compared to our mouse model
of disease. Muc2, Muc3, Muc6, and TFF3 appear to have limited expression in the
normal murine stomach and these are not altered by murine H. felis infection. This is in
contrast to expression patterns reported in human stomach, where MUC6 is expressed in
the normal stomach and is lost during progression to gastric cancer; and TFF3 is not
expressed by immunohistochemistry in the normal human stomach but is increased in
intestinal metaplasia.
As human gastric biopsies are usually taken as histological diagnosis of gastric
adenocarcinoma, the addition of some type of immunofluorescence analysis for mucins
that might predict progression to disease would be a valuable diagnostic tool. Our data
clearly indicates that a loss of Muc5ac and a gain of Muc4 and Muc5b correlate with
disease progression. Although similar changes in MUC4 and MUC5AC have previously
77
Table III: Comparison of Human and Murine Mucin Changes
Normal
Gastric
Reference Normal
Gastric - Adenocarcinoma
Gastric Human
– Human
Mouse
Yes
Increased
(Wang
Yes
MUC1
and Fang
2003)
No
Increased
(Babu et
Yes
MUC2
al. 2006;
Roessler
et al.
2005)
No
Increased
(Ho et al. Yes
MUC3
1995;
Wang and
Fang
2003)
No
Increased
(Ho et al. Yes
MUC4
1995)
No
Increased
(Pinto-de- Yes
MUC5b
Sousa et
al. 2004)
Yes
Decreased
(Babu et
Yes
MUC5AC
al. 2006;
Marques
et al.
2005)
Yes
Decreased
(Babu et
Yes
MUC6
al. 2006;
Marques
et al.
2005)
Yes
Decreased
(Muller
Yes
TFF1
and
Borchard
1993;
Wong et
al. 1999)
Yes
Yes
(Dhar et
Yes
TFF2
al. 2005;
Hu et al.
2003)
No
Yes
(intestinal
(Taupin et Yes
TFF3
metaplasia)
al. 2001)
*Decreased in body of stomach by immunofluorescence.
**Confirmed by immunofluorescence analysis.
78
H. felis Model
(RNA-24
weeks)
No change**
No change
Decreased**
Increased**
Increased
No change*
No change
Decreased
No change
No change
been seen in human biopsies of gastric adenocarcinoma, it is not known whether these
changes precede the cancerous changes.
The loss of Muc5ac has been proposed to be a key alteration in the progression to
gastric adenocarcinoma. By losing a key part of the mucin layer which interacts with the
trefoil factors, the tissue of the stomach may demonstrate decreased repair in response to
injury and thus the gastric adenocarcinoma develops. Our data from the H. felis infected
immunodeficient B6.RAG1-/- mouse would indicate that this change in Muc5ac, in the
continuing presence of Helicobacter colonization, is not sufficient for adenocarcinoma
formation. Some factor in the adaptive immune response is also critical to the disease
progression. The effect of the adaptive immune system after infection on the expression
of Muc4 and Muc5b imply that these two mucins may play a critical role in progression
to gastric cancer. Since these changes occurred early in the disease process (as early as 4
weeks, data not shown) they could be explored as a early marker for lesions predisposed
to progression to gastric adenocarcinoma and could potentially allow pathologists to
detect precancerous lesions and allow gastroenterologists to institute early treatment.
These findings strengthen the approach of using a mouse model to learn more about
disease. Specifically, multiple aspects of the disease process can be manipulated, and as
we know the starting point of infection, we can closely follow disease progression. If a
change is evident in the model prior to progression to gastric adenocarcinoma it may lead
to the development of novel treatment strategies. To date a Muc4 or Muc5b deficient
mouse has not been created. Future studies could involve such models to determine if
they do play a critical role in progression to gastric adenocarcinoma.
79
ACKNOWLEDGMENTS
This work was supported in part by American Cancer Society Grant RPG-99-086-01MBC, the NIH grants R01 DK059911, P01 DK071176, and the University of Alabama at
Birmingham Digestive Diseases Research Development Center Grant #P30 DK064400.
JMS received salary support from the NIH training grant T32 AI07041. We thank Dr.
Samuel Ho for the generous gift of the Muc3 and Muc4 antibodies.
80
REFERENCES
Babu SD, Jayanthi V, Devaraj N, Reis CA, Devaraj H (2006) Expression profile of
mucins (MUC2, MUC5AC and MUC6) in Helicobacter pylori infected pre-neoplastic
and neoplastic human gastric epithelium. Mol Cancer 5:10
Bas A, Forsberg G, Hammarstrom S, Hammarstrom ML (2004) Utility of the
housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphatedehydrogenase for normalization in real-time quantitative reverse transcriptasepolymerase chain reaction analysis of gene expression in human T lymphocytes. Scand J
Immunol 59:566-573
Brockhausen I (2003) Glycodynamics of mucin biosynthesis in gastrointestinal tumor
cells. Adv Exp Med Biol 535:163-188
Brown JK, Pemberton AD, Wright SH, Miller HR (2004) Primary antibody-Fab fragment
complexes: a flexible alternative to traditional direct and indirect immunolabeling
techniques. J Histochem Cytochem 52:1219-1230
Cai X, Carlson J, Stoicov C, Li H, Wang TC, Houghton J (2005) Helicobacter felis
eradication restores normal architecture and inhibits gastric cancer progression in
C57BL/6 mice. Gastroenterology 128:1937-1952
Chen Y, Zhao YH, Kalaslavadi TB, Hamati E, Nehrke K, Le AD, Ann DK, Wu R (2004)
Genome-wide search and identification of a novel gel-forming mucin MUC19/Muc19 in
glandular tissues. Am J Respir Cell Mol Biol 30:155-165
Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159
Clyne M, Dillon P, Daly S, O'Kennedy R, May FE, Westley BR, Drumm B (2004)
Helicobacter pylori interacts with the human single-domain trefoil protein TFF1. Proc
Natl Acad Sci U S A 101:7409-7414
Correa P (1988) A human model of gastric carcinogenesis. Cancer Res 48:3554-3560
de Bolos C, Real FX, Lopez-Ferrer A (2001) Regulation of mucin and glycoconjugate
expression: from normal epithelium to gastric tumors. Front Biosci 6:D1256-1263
Dhar DK, Wang TC, Tabara H, Tonomoto Y, Maruyama R, Tachibana M, Kubota H,
Nagasue N (2005) Expression of trefoil factor family members correlates with patient
prognosis and neoangiogenesis. Clin Cancer Res 11:6472-6478
Escande F, Porchet N, Bernigaud A, Petitprez D, Aubert JP, Buisine MP (2004) The
mouse secreted gel-forming mucin gene cluster. Biochim Biophys Acta 1676:240-250
81
Fox JG, Blanco M, Murphy JC, Taylor NS, Lee A, Kabok Z, Pappo J (1993) Local and
systemic immune responses in murine Helicobacter felis active chronic gastritis. Infect
Immun 61:2309-2315
Fox JG, Rogers AB, Whary MT, Ge Z, Ohtani M, Jones EK, Wang TC (2007)
Accelerated progression of gastritis to dysplasia in the pyloric antrum of TFF2 -/C57BL6 x Sv129 Helicobacter pylori-infected mice. Am J Pathol 171:1520-1528
Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR. Genome
Res 6:986-994
Higuchi T, Orita T, Nakanishi S, Katsuya K, Watanabe H, Yamasaki Y, Waga I,
Nanayama T, Yamamoto Y, Munger W, Sun HW, Falk RJ, Jennette JC, Alcorta DA, Li
H, Yamamoto T, Saito Y, Nakamura M (2004) Molecular cloning, genomic structure,
and expression analysis of MUC20, a novel mucin protein, up-regulated in injured
kidney. J Biol Chem 279:1968-1979
Ho SB, Shekels LL, Toribara NW, Kim YS, Lyftogt C, Cherwitz DL, Niehans GA (1995)
Mucin gene expression in normal, preneoplastic, and neoplastic human gastric
epithelium. Cancer Res 55:2681-2690
Hoffmann W, Hauser F (1993) The P-domain or trefoil motif: a role in renewal and
pathology of mucus epithelia? Trends Biochem Sci 18:239-243
Hu GY, Yu BP, Dong WG, Li MQ, Yu JP, Luo HS, Rang ZX (2003) Expression of TFF2
and Helicobacter pylori infection in carcinogenesis of gastric mucosa. World J
Gastroenterol 9:910-914
Kaneko Y, Yanagihara K, Miyazaki Y, Hirakata Y, Mukae H, Tomono K, Okada Y,
Kadota J, Kohno S (2003) Overproduction of MUC5AC core protein in patients with
diffuse panbronchiolitis. Respiration 70:475-478
Karnes WE, Jr., Samloff IM, Siurala M, Kekki M, Sipponen P, Kim SW, Walsh JH
(1991) Positive serum antibody and negative tissue staining for Helicobacter pylori in
subjects with atrophic body gastritis. Gastroenterology 101:167-174
Katoh M (2003) Trefoil factors and human gastric cancer (review). Int J Mol Med 12:3-9
Kawakubo M, Ito Y, Okimura Y, Kobayashi M, Sakura K, Kasama S, Fukuda MN,
Fukuda M, Katsuyama T, Nakayama J (2004) Natural antibiotic function of a human
gastric mucin against Helicobacter pylori infection. Science 305:1003-1006
Kikuchi S (2002) Epidemiology of Helicobacter pylori and gastric cancer. Gastric Cancer
5:6-15
82
Kurt-Jones EA, Cao L, Sandor F, Rogers AB, Whary MT, Nambiar PR, Cerny A, Bowen
G, Yan J, Takaishi S, Chi AL, Reed G, Houghton J, Fox JG, Wang TC (2007) Trefoil
family factor 2 is expressed in murine gastric and immune cells and controls both
gastrointestinal inflammation and systemic immune responses. Infect Immun 75:471-480
Lauren P (1965) The Two Histological Main Types Of Gastric Carcinoma: Diffuse And
So-Called Intestinal-Type Carcinoma. An Attempt At A Histo-Clinical Classification.
Acta Pathol Microbiol Scand 64:31-49
Lee A, Fox JG, Otto G, Murphy J (1990) A small animal model of human Helicobacter
pylori active chronic gastritis. Gastroenterology 99:1315-1323
Leung WK, Sung JJ (2002) Review article: intestinal metaplasia and gastric
carcinogenesis. Aliment Pharmacol Ther 16:1209-1216
Marques T, David L, Reis C, Nogueira A (2005) Topographic expression of MUC5AC
and MUC6 in the gastric mucosa infected by Helicobacter pylori and in associated
diseases. Pathol Res Pract 201:665-672
McCracken VJ, Martin SM, Lorenz RG (2005) The Helicobacter felis model of adoptive
transfer gastritis. Immunol Res 33:183-194
Mohammadi M, Redline R, Nedrud J, Czinn S (1996) Role of the host in pathogenesis of
Helicobacter-associated gastritis: H. felis infection of inbred and congenic mouse strains.
Infect Immun 64:238-245
Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE (1992)
RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68:869-877
Muller W, Borchard F (1993) pS2 protein in gastric carcinoma and normal gastric
mucosa: association with clincopathological parameters and patient survival. J Pathol
171:263-269
Nomura S, Baxter T, Yamaguchi H, Leys C, Vartapetian AB, Fox JG, Lee JR, Wang TC,
Goldenring JR (2004) Spasmolytic polypeptide expressing metaplasia to preneoplasia in
H. felis-infected mice. Gastroenterology 127:582-594
Parkin DM, Bray F, Ferlay J, Pisani P (2005) Global cancer statistics, 2002. CA Cancer J
Clin 55:74-108
Pinto-de-Sousa J, Reis CA, David L, Pimenta A, Cardoso-de-Oliveira M (2004) MUC5B
expression in gastric carcinoma: relationship with clinico-pathological parameters and
with expression of mucins MUC1, MUC2, MUC5AC and MUC6. Virchows Arch
444:224-230
83
Reis CA, David L, Nielsen PA, Clausen H, Mirgorodskaya K, Roepstorff P, SobrinhoSimoes M (1997) Immunohistochemical study of MUC5AC expression in human gastric
carcinomas using a novel monoclonal antibody. Int J Cancer 74:112-121
Ringel J, Lohr M (2003) The MUC gene family: their role in diagnosis and early
detection of pancreatic cancer. Mol Cancer 2:9
Roessler K, Monig SP, Schneider PM, Hanisch FG, Landsberg S, Thiele J, Holscher AH,
Dienes HP, Baldus SE (2005) Co-expression of CDX2 and MUC2 in gastric carcinomas:
correlations with clinico-pathological parameters and prognosis. World J Gastroenterol
11:3182-3188
Roth KA, Kapadia SB, Martin SM, Lorenz RG (1999) Cellular immune responses are
essential for the development of Helicobacter felis-associated gastric pathology. J
Immunol 163:1490-1497
Ruchaud-Sparagano MH, Westley BR, May FE (2004) The trefoil protein TFF1 is bound
to MUC5AC in human gastric mucosa. Cell Mol Life Sci 61:1946-1954
Shirazi T, Longman RJ, Corfield AP, Probert CS (2000) Mucins and inflammatory bowel
disease. Postgrad Med J 76:473-478
Taupin D, Pedersen J, Familari M, Cook G, Yeomans N, Giraud AS (2001) Augmented
intestinal trefoil factor (TFF3) and loss of pS2 (TFF1) expression precedes metaplastic
differentiation of gastric epithelium. Lab Invest 81:397-408
Van De Bovenkamp JH, Korteland-Van Male AM, Buller HA, Einerhand AW, Dekker J
(2005) Infection with Helicobacter pylori affects all major secretory cell populations in
the human antrum. Dig Dis Sci 50:1078-1086
Van den Brink GR, Tytgat KM, Van der Hulst RW, Van der Loos CM, Einerhand AW,
Buller HA, Dekker J (2000) H pylori colocalises with MUC5AC in the human stomach.
Gut 46:601-607
Vanagunas A (1998) The Link Between Helicobacter pylori and Gastric Cancer. Infect
Med 15:644 - 650, 656
Wang RQ, Fang DC (2003) Alterations of MUC1 and MUC3 expression in gastric
carcinoma: relevance to patient clinicopathological features. J Clin Pathol 56:378-384
Wong WM, Poulsom R, Wright NA (1999) Trefoil peptides. Gut 44:890-895
84
HELICOBACTER FELIS ASSOCIATED GASTRIC PATHOLOGY IN GNOTOBIOTIC
MICE
by
JULIA M. SCHMITZ, TRENTON R. SCHOEB, THOMAS D. SOLTAU, VANCE J.
MCCRACKEN, AND ROBIN G. LORENZ
In preparation for submission to Journal of Immunology
Format adapted for dissertation
85
ABSTRACT
Human infection with Helicobacter pylori leads to multiple pathologic
consequences, including the development of gastric adenocarcinoma. Although H. pylori
is classified as a type-1 carcinogen, it is not clear if there are additional non-Helicobacter
factors required for cancer induction. In this study we analyzed the potential role of nonHelicobacter gastric microbiota in the development of gastric pathology after H. felis of
C57BL/6 mice. Two different gnotobiotic murine models were used. The first model was
free of all bacteria in the system except for the added H. felis (B6.GB). The second model
utilized mice colonized with the well defined Altered Schaedler Flora (B6.ASF). When
these two gnotobiotic models, as well as our specific pathogen-free mice (B6.SPF) were
infected with H. felis, all three models showed similar histological changes over the
course of the infection, indicating that Helicobacter alone is sufficient to induce gastric
pathology. However, when the colonization levels were compared, there was a
significant different between the three strains. The H. felis infected B6.GB and B6.ASF
mice did not clear the gastric helicobacter, while the infected B6.SPF eliminated all
detectable H. felis. In order to understand the continuing inflammation in the B6.SPF
stomach in the absence of pathogenic H. felis, we analyzed the gastric microbiological
community by denaturing gradient gel electrophoresis. Our results indicate that
additional bacteria are able to thrive in the stomach of H. felis infected B6.SPF animals,
but not in the stomachs of the B6.GB or B6.SPF. These findings support the concept that
there are multiple triggers of helicobacter-associated gastric inflammation, including nonhelicobacter microbiota. As the normal gastric milieu is not conductive to the growth of
86
most bacteria, these results indicated that one mechanism of helicobacter-induced gastric
pathology is the alteration of the gastric environment to allow colonization by other
microbiota.
87
INTRODUCTION
Helicobacter pylori infection is the most common bacterial infection worldwide
(1, 2). In a subset of infected individuals, infection is associated with gastric atrophy, loss
of parietal cells, and chronic active gastritis (3-5). These alterations lead to a significant
change in the protective mucus layer of the stomach, as well as a change towards a more
neutral pH. These alterations have been proposed to allow environmental carcinogens
and microbial components more direct access to the gastric epithelium causing
subsequent alterations in cellular DNA and eventual gastric adenocarcinoma. Gastric
adenocarcinoma is the second leading cause of cancer death and the fourth most
prevalent cancer worldwide (4, 6). The study of helicobacter-associated gastric
adenocarcinoma development has focused on animal models of disease, including the H.
pylori infected Mongolian gerbil and the H. felis (ATCC 49179) infected C57BL/6
mouse (7-10). These models develop an intestinal type of gastric adenocarcinoma, which
progresses through a series of alterations in the epithelial cells that include atrophy,
metaplasia, and dysplasia with 100% of mice progressing to gastric adenocarcinoma after
infection with Helicobacter felis for 12 to 15 months (5)
The potential role of microbial components other than Helicobacter in this
progression to gastric carcinoma has not been well studied. The mammalian body is a
host to numerous microbial populations especially in the gastrointestinal tract. This
microbiome exceeds the number of cells in the host by a factor of 10 (11). The stomach
was previously considered to be a sterile environment due to the highly harsh acidic
environment and it was thought that any bacteria found there came from ingested
88
materials or was passed down from the oral cavity (11-13). Recent studies have shown
that there is a great diversity of bacteria surviving in the stomach of humans. Using
broad-range PCR and 16S rDNA sequence analysis, approximately 128 phylotypes were
found and were similar to what is found in the lower gastrointestinal tract (14-16). By
histology and bacterial culture it was shown that stomachs of mice contain lactobacilli
and Group N streptococci (17).
Yamaguchi, et.al. demonstrated that specific pathogen free (SPF) C57BL/6 mice
and germ-free (GF) IQI mice, when immunized with H. pylori heat shock protein 60 and
then infected with H. pylori 1402, only developed post-immunization gastritis in the
presence of bacterial flora (18). Two studies have investigated the effect of H. pylori
infection on the gastric microbial ecosystem. Aebischer et.al. utilized clone libraries of
gastric16S rRNA genes to analyze the composition of the gastric microbiota in BALB/c
mice infected with H. pylori (strain P76) for 8 weeks. It was determined that that in noninfected mice lactobacilli dominated the gastric microbiota, while the infected stomachs
were colonized with Clostridia, Bacteroides/Prevotella spp., Eubacterium spp.,
Ruminococcus spp., Streptococci, and E. coli, all of which are bacteria that are normally
located in the lower intestinal tract, showing that H. pylori could be enabling gut bacteria
to adapt to gastric conditions (19). In contrast to this report, Tan, et.al. has reported that
the gastric microbiota did not change over the six months after infection of C57BL/6
mice with H. pylori (strain SS1) (2). The dominant gastric species in their studies were
Lactobacillus reuteri and L. murinus.
One drawback to these studies is that they only evaluated alterations in gastric
microbiota after murine infection with H. pylori. As it is clear that this human pathogen
89
does not cause significant gastric pathology in mice, these studies do not critically test the
role of non-helicobacter microbiota on the induction of gastritis and subsequent gastric
epithelial alterations. It has been shown that H. felis (strain CS1) can infect Germ-free
(GF) Swiss Webster mice for up to eight-weeks and cause a progression from acute
inflammation to active chronic inflammation, as seen in human infection (20). However,
only one study has investigated the long-term contribution of the microbiological
community after H. felis infection, which has been shown to induce gastric pathology and
gastric adenocarcinoma in C57BL/6 mice (5). Fox et.al infected outbred Swiss Webster
GF mice with H. felis for 50 weeks. These mice developed a chronic gastritis, however
since there were no „normal‟ SPF mice included in this study, the influence of
commensal gastric microbiota was not studied (21).
In order to critically test the role of non-Helicobacter gastric bacteria in the
gastritis and subsequent gastric dysplasia associated with H. felis infection we infected
germfree C57BL/6 mice (22). These mice, which have an absence of any type of
additional bacteria, will determine if H. felis alone (along with the immune response it
initiates) is sufficient to cause the gastric alterations seen after infection, or if the
Helicobacter infection also alters the gastric microbiological environment and if this
alteration is important in gastric pathology.
While mice colonized with only H. felis are a critical test of the role of the role of
other microbiota in gastric pathology, this is clearly a very artificial environment. In
order to more closely mimic the normal gastric environment, while still controlling the
microbiological exposure, we utilized a specific gnotobiotic model that has been
colonized with Altered Schaedler Flora (ASF) (23). These mice are generated by
90
colonizing GF mice with a cocktail of eight known bacterial strains, therefore allowing
for a standardized microflora to be investigated. The ASF contains Clostridium sp.
(ASF356), Lactobacillus sp. (ASF360), Lactobacillus murinus (ASF361), Flexistipes
group (ASF457), Eubacterium plexicaudatum (ASF492), low G + C content gram
positive group (ASF500), Clostridum sp. (ASF502), and Bacteroides sp (ASF519). (2325). In a study that analyzed the spatial distribution of the ASF throughout the
gastrointestinal tract of recently colonized C.B-17 SCID mice, it was shown that
approximately 1.59 x 106 bacteria/gram were found in the glandular stomach, with 50%
of the bacteria in the stomach being identified as Lactobacillus murinus (24). We utilized
these controlled microbial mice to investigate the effect of ASF bacteria on the
histological, immunological, and epithelial changes that occur after H. felis infection of
C57BL/6 mice.
91
MATERIALS AND METHODS
Mice
Three inbred mouse strains between 6 and 10 weeks of age at the time of initial
infection were used in this study. All animals were female, except for gnotobiotic animals
and their B6 controls at the 16 week time-point which contained a mix of males and
females. C57BL/6J specific pathogen free (B6.SPF) mice were obtained from The
Jackson Labs, Bar Harbor, ME and housed in ventilated rack. The detailed list of our
facility‟s SPF conditions can be accessed at
http://main.uab.edu/sites/ComparativePathology/surveillance/. B6.SJL-Ptprca Pepcb/BoyJ
(gnotobiotic; B6.GB) and B6.SJL-Ptprca Pepcb/BoyJ (Altered Schaedler Flora; B6.ASF)
were maintained in Trexler-type (Standard Safety Equipment Co., Palatine, IL) or semirigid isolators (Park Bioservices, Groveland, MA) according to standard gnotobiotic
methods (26). All mice were raised on autoclaved standard laboratory mouse chow (NIH31, Harlan Teklad, Madison, WI) and filter sterilized autoclaved water ad lib and housed
in a facility that maintained a 12:12-hr light-dark schedule. Germfree status was
monitored by monthly aerobic and anaerobic cultures of fecal and water samples and by
examination of gram stained fecal specimens. Colonization with ASF organisms was
monitored initially by examination of gram stained fecal specimens for each bacterial
morphologic type (27, 28). All animal protocols and procedures were conducted in
accordance with the Institution Animal Care and Use Committee at the University of
Alabama at Birmingham (Birmingham, AL).
92
H. felis infections
The three different strains of mice, B6.SPF, B6.GB, and B6.ASF, were mockinfected or H. felis infected as described previously (8). Briefly, the mice were orally
infected on days 1, 4, and 7 with 5 X 107 CFU H. felis (ATCC 49179) with 25 L in
brain-heart infusion broth (BHI)/glycerol. This infection protocol results in 100%
efficiency in our laboratory. The mock infected mice received sterile BHI/glycerol
without bacteria.
Tissue Preparation
Sacrifice of the mice was performed using isofluorane inhalation followed by
cervical dislocation. Immediately following sacrifice, the stomach was removed and
quartered. One quarter was immersed in RNALater (Ambion; Austin, TX) for RNA
isolation and one quarter was immersion fixed in Carnoy‟s solution (6:3:1 of 100%
ethanol, chloroform, and glacial acetic acid) for 4 hours at 4oC, than changed to ethanol,
and placed in cassettes for embedding in paraffin. The tissue was cut into five-micron
sections on a microtome and attached to pre-cleaned microscope slides (Snowcoat X-tra,
Surgipath; Richmond, IL). A third quarter was snap frozen in liquid nitrogen and stored
at -80oC until ready for DNA isolation for Denaturing Gradient Gel Electrophoresis
(DGGE) analysis. The last quarter was immediately homogenized in a solution of
500mM NaCl/ 50mM Hepes containing 0.1% Triton, 0.02% NaN3, and mammalian
protease inhibitor (Sigma, St. Louis, MO) at a pH of 7.4 for protein analysis (29). The
solution is then frozen overnight, followed by centrifugation at 6,000 RPM for 20
minutes.
93
Total RNA was isolated from the quarter stomach using the phenol and guanidine
isothiocyanate method with Trizol® (Invitrogen; Carlsbad, CA) (30). The total RNA was
processed through a genomic DNA clean-up step utilizing the Turbo DNase kit (Ambion,
Austin, TX). cDNA was made with equal amounts of mRNA (2 g), using the Roche
Trasncriptor First Strand cDNA Synthesis Kit (Roche, Pensberg, Germany). Using
Applied Biosystems Assays-On-Demand primer/probe sets (Table 1) and TaqMan
Universal PCR Mix (PE Applied Biosystems, Foster City, CA), quantitative real-time
reverse transcription polymerase chain reaction (qRT-PCR) was performed on the
MX3000P real-time PCR machine (Stratagene, La Jolla, CA). Data was analyzed by the
“delta-delta Ct” relative quantitation method as described in Applied Biosystems
manufactor‟s instructions (4371095 Rev A, PE Applied Biosystems; Foster City, CA). In
short, the average crossing threshold of each target gene is subtracted from the average
crossing threshold of the housekeeping gene (18S) to determine the relative expression
(Ct). To determine the Ct the average Ct of the experimental animals
(Helicobacter-infected) is subtracted from the average control (mock-infected) Ct for
each gene and set of animals. The Ct is then used in the formula 2Ct to determine the
fold change in mRNA expression. To determine the upper and lower limits of fold
change the standard deviation of the average of each experimental group was taken
through the above calculations (31, 32).
Scoring of Histology and H. felis colonization
Tissue sections of the stomach were stained with Hematoxin and Eosin and
graded by two scientists blinded to the experimental groups (RGL and JMS). The
94
Table 1: Primer-Probe pairs utilized for qRT-PCR
Gene
Applied Biosystems
Exons of probes Gene ID
Catalogue Number*
18S – housekeeping
Hs99999901_s1
None
LOC100008588
gene
Muc5ac
Mm01276725_g1
33 – 34
mCG142254
TFF1
Mm00436945_m1
1-2
mCG14583
ATPase
Mm00444423_m1
18 - 19
mCG22783
IF
Mm00433596_m1
5–6
mCG12895
Pep
Mm00482488_m1
5–6
mCG15560
TSLP
Mm00498739_m1
4–5
mCG119968
CXCL15
Mm00441263_m1
1–2
mCG1706
LIX
Mm00436451_g1
1–2
mCG1701
KC
Mm00433859_m1
3–4
mCG1708
MIP2
Mm00436450_m1
3–4
mCG1710
Mm00801778_m1
1–2
mCG1237
IFN
IL-17
Mm00439619_m1
2–3
mCG7914
IL-10
Mm00439616_m1
3–4
mCG2645
Mm00441724_m1
1–2
mCG7649
TGF
FoxP3
Mm00475156_m1
1–2
mCG3948
IL-6
Mm00446190_m1
2–3
mCG11634
Mm00443258_m1
1
–
2
mCG15911
TNF
Mm00434228_m1
3–4
mCG20999
IL-1
MPO
Mm00447886_m1
13 – 14
mCG119373
*All genes were purchased from Applied Biosystems (Foster City, CA).
95
histological score can range from 0 to 9 (0 – no inflammation and no epithelial changes; 9
– severe inflammation and epithelial changes) with subscores of 0 to 3 for each of the
following three areas: longitudinal extent of inflammation, vertical extent of
inflammation, and histological changes.
To semi-quantitate the level of H. felis gastric colonization, each stomach section
was stained with rabbit anti-H. pylori antibody (SIG-3431, use at full concentration,
Covance, Emeryville, CA). Studies were done in our lab to determine that it does crossreact with H. felis (unpublished data). Briefly, the stomach sections were depariffinized
with Citrosolv (Fisher Scientific, Pittsburgh, PA) and isopropanol. The sections are then
rehydrated with phosphate buffered saline (PBS) and pretreated with 0.25% pepsin in
PBS for 10 minutes at room temperature. PBS-blocking buffer (1% bovine serum
albumin and 0.3% Triton) was added to the slides to block non-specific binding proteins
and to permeabilize the cell. After the blocking step, the slides were incubated with antiHelicobacter antibody for one hour at room temperature followed by a wash in PBS. For
visual detection the slides were incubated with Cy3 donkey anti-rabbit (711-165-152; 6
g/mL, use at 1:250 dilution; Jackson Immunoresearch, West Grove, PA) for one hour.
Finally for visualization of the nuclei the sections were counterstained with Hoechst
33258 (09460; 2 g/mL, use at 1:2000 dilution; Sigma, St. Louis, MO). Scoring was as
described above, scoring both the antrum and esophageal junction on a 0 to 4 scale; 0 =
no bacteria per gland, 1 = 1 – 2 bacteria per gland, 2 = 3 – 10 bacteria per gland, 3 = 11 –
20 bacteria per gland, and 4 = >20 bacteria per gland. The scores for each section were
averaged between the two scorers. The averages of the sections are then graphed.
96
Scoring of Muc5ac by immunofluorescene
To access the expression of Muc5ac, stomach sections were stained using a
“mouse on mouse” protocol (33). The sections were deparaffinized, rehydrated, and
blocked as described above. The primary antibody (mouse monoclonal IgG1 antiMuc5ac (clone 45M1); 200g/mL, MS-145-PO, Thermo Scientific, Fremont, CA) and
secondary detection antibody (Cy3 Fab Goat anti Mouse; 115-167-003; Jackson
Immunoresearch; West Grove, PA) are incubated together at a 1:2 ratio (w/w) for 40
minutes at room temperature in triton-free PBS-BB. Excess mouse serum was added to
the antibody mixture for 10 minutes to block unbound Fab fragments, after which the
solution was diluted to 1:100 (final) and placed on the slide. The slides were scored on a
0 – 3 scale; with 0 = no staining and 3 = bright staining. Each stomach section was scored
in two areas – body and antrum. The antral scores were utilized as a positive control, as
Helicobacter infection only effects expression of Muc5ac in the body of the stomach.
Only stomach sections that received a score of 2 or 3 in the antrum were used for further
analysis.
Extraction of DNA from Stomachs
One-quarter of mouse stomachs were flash frozen in liquid nitrogen and then
stored at -80 C. DNA extraction from luminal bacteria was performed using four washes
of 0.1% Tween (Fisher Biotech) in Phosphate Buffered Saline (Mediatech). The stomach
was combined with 5 ml of this solution and vortexed for 30 seconds. The wash solution
was collected leaving the tissue behind. The collected washes were centrifuged at 5000
97
RPM for 15 minutes. The pellet was resuspended in tris/EDTA (TE, pH 8.0 Ambion) and
tris saturated phenol and combined with 200 L of 0.1 mm glass beads. This solution was
shaken for two 15 minute episodes with 5 minute in an ice bath following each episode.
This solution was centrifuged for 5 minutes at 11000 rpm. Phenol chloroform (PC) was
used to extract DNA. Two successive PC extractions were performed, with centrifugation
at 11000 RPM x 5 minutes between steps, removing the top layer for the next step. After
the second PC extraction the supernatant was combined with sodium acetate and 100%
ethanol. This was allowed to sit on ice for 5 minutes to allow precipitation of DNA. This
was centrifuged at 11000 RPM for five minutes. The pellet was washed with 70% ethanol
and centrifuged again. The pellet was then resuspended in TE.
PCR of Gastric Washes
DNA samples were exposed to polymerase chain reaction (PCR) to replicate 16S
ribosomal DNA. A master mix of 5 L/sample 10X buffer (Takara Bio inc), 4 L/sample
deoxyribonucleic acid nucleotides (Takara Bio inc), 0.25 L/sample Hotstart Taq
polymerase (Takara Bio inc), sterile water 8.75 L/sample, and 1 L/sample of both
forward and reverse primers was prepared (20 L/sample). The forward primer used was
5‟CGCCCGCCGCGCGCGGCGGGCGGGGGGGGCACGGGGGGCCTACG
GGAGGCAGCAG 3‟ (Sigma). The reverse primer used was 5‟ATTACCGCGGCTGCT
GG 3‟(Sigma). The master mix was combined with 150 nanograms of DNA and water to
make a total reaction volume of 50 L. This was then exposed to the following PCR
conditions utilizing a Perkins-Elmer Gene Amp PCR System 2400. Initial denaturation of
95 C for 5 min followed by: 20 cycles of 95 C for 1 min, an annealing step for 45 sec,
98
and 72 C for 1 min. Initial annealing temperature was 65 C, this was ramped down 0.5
C per cycle over the 20 cycles. Following the 20 cycles, 10 additional cycles of 95 C for
1 minute, 55 C for 45 seconds, and 72 C for 1 minute were performed. A final step of
72 C for 5 minutes was performed and the samples were stored at -20 C.
Denaturing Gradient Gel Electrophoresis of Gastric Washes
A Bio-Rad DCode system (Bio-Rad Laboratories) was used to perform DGGE.
Stock solutions of 35% (20 mL 40% acrylamide, 2 mL of 50x TAE, 14.7 g urea, 14 mL
of deionized formamide, and deionized water to make total volume of 100mL) and 60%
(20 mL 40% acrylamide, 2 mL of 50x TAE, 25.2 g urea, 24 mL of deionized formamide,
and deionized water to make total volume of 100mL) were made. Right before pouring
the gels 16 L of Temed (tetra-methyl-ethylenediamine, Bio-Rad laboratories) and 100
microliters of 0.1 gram/mL ammonium persulfate (Bio-Rad laboratories) were added to
16 mL of each of the stock solutions. The gradient was made with Bio-Rad Gradient
Delivery System (Model 475, Bio-Rad Laboratories). After 2 hours of polymerization,
the gel was loaded with a combination of 25 L of the PCR product and 25 L of loading
buffer. Gels were ran overnight at 58 C and 60 volts. The gel was stained with ethidium
bromide (Bio-Rad Laboratories) and visualized and imaged under ultraviolet light.
Serum and Fecal Collection
Whole blood was collected immediately upon sacrifice by cardiac puncture.
Blood was allowed to clot for one hour and serum was separated by centrifugation at
13000 RPM. The sera samples were stored at -20oC until assays were preformed.
99
During the sacrifice of the animals, fresh fecal samples were collected. A solution of PBS
supplemented with 0.05% NaN3 and mammalian protease inhibitor (10 L/mL, Sigma,
St. Louis, MO) was added to the feces at a concentration of 10 L/mg of feces. The
solution and feces were vortexed and then frozen overnight at -20oC. The frozen solution
was allowed to thaw on ice and was then vortexed for 10 minutes followed by
centrifugation at 13000 RPM. The supernatants from this spin are stored at –20oC until
further analysis.
Preparation of H.felis Antigen
The organisms were harvested as described for inoculation, washed in PBS, and
sonicated on ice for 30 seconds, with 30 seconds cooling for a total of 4 minutes using
setting 4 on Branson Sonifer 250 (Branson Ultrasonics, Danbury, CT). The bacterial
suspension was centrifuged at 20,000 x g at 4oC for 20 minutes. The supernatant was
passed through a 0.22 m filter and supernatants were frozen at -80oC until further use.
Total protein concentration was determined by the DC Protein Assay (Bio-Rad, Hercules,
CA).
Analysis of Total and H. felis-Specific and Serum and Fecal Antibodies
ELISAs were performed to determine the specific antibody response to H. felis in
both fecal and serum samples. In brief, a 96-well Immunlon Assay Plate (Fisher
Scientific, Pittsburgh, PA) was coated with H. felis sonicate (10 g/mL in PBS) overnight
at 4oC. Plates were washed 5 times with PBS with 0.05% Tween and nonspecific binding
sites were blocked with 5% Bovine Serum Albumin (Fisher Scientific, Pittsburgh, PA) in
100
PBS for one hour at room temperature (RT). The plate was washed as before and then
samples diluted in 1% BSA in PBS were incubated for two hours at room temperature.
After a wash of five cycles, alkaline phosphatase-linked goat anti-mouse IgG or IgA were
diluted 1:2000 in 1% BSA in PBS was added to the wells and incubated for 2 hours at RT
(IgG, Cat. #1030-04; IgA, Cat. #1040-04, Southern Biotech; Birmingham, AL). The plate
was washed another five times, and then the bound secondary antibody was detected
using pNPP substrate solution (N-2770, Sigma, St. Louis, MO). The plates were read on
a VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA) at 405 nm. To
determine the concentration of IgA or IgG anti-H. felis, a standard curve of the
corresponding Ig (5300-01; Southern Biotech, Birmingham, AL) was run on each plate
as described above with the exception of coating the plate with 10g/mL goat anti-mouse
Ig (#1010-01, Southern Biotech, Birmingham, AL). For analysis of total antibody
response the protocol for H. felis specific ELISA was followed with the substitution that
the initial coating antibody was 10g/mL goat anti-mouse Ig (instead of H. felis
sonicate).
Graphic and Statistical Analysis
All graphs were made using GraphPad Prism 4® (San Diego, CA). All qRT-PCR
graphs are horizontal with the y-axis set at one to represent the baseline expression for
each gene for each set of animals. The infected animals are always compared back to
their own mock controls. The mean and range is represented in the graph. Statistics on
continuous data was performed using the unpaired t-test in GraphPad InStat 3® (San
101
Diego, CA). Statistics on non-continuous data was performed with the Mann Whitney U
test. Statistical significance is indicated by an * with a p<0.05.
102
RESULTS
Gastric Histology and Colonization after H. felis Infection.
B6.SPF, B6.GB, and B6.ASF animals were infected for 8, 16, and 24 weeks with
H. felis. At all time points, the mock-infected stomachs of all three animal models have a
normal stomach architecture, with parietal and zymogenic cells evident and no
inflammation present (Fig. 1, Panels A, C, and E, 24 week time point shown). After 24
weeks of H. felis infection, the overall gastric histology appears similar between the
B6.SPF, B6.GB, and B6.ASF animals, with a loss of parietal and zymogenic cells, gastric
dysplasia, and increased inflammatory infiltrate (Fig. 1, Panels B, D, and F). The
histological scores for the mock-infected models over time were all similar to unmanipulated controls (data not shown), while the majority of H. felis infected mice
showed maximal inflammation and epithelial alterations by 8 weeks after infection (Fig.
1, Panels G, I, and K; individual scores with horizontal line at median for B6.SPF,
B6.GB, and B6.ASF). The B6.SPF maintains this maximal histological score over 24
weeks of infection, while the histological scores are slightly decreased over time in the
infected B6.ASF stomachs. The B6.GB median histological score is initially lower than
the B6.SPF or B6.ASF mice, and does not change over the length of the experiment.
Our previously published results have indicated that in the B6 mouse strain
inflammation is inversely correlated to H. felis colonization (8). Therefore, we evaluated
the level of gastric colonization in all three mouse models (Fig. 1, Panels H, J, and L;
individual scores with horizontal line at median for B6.SPF, B6.GB, and B6.ASF).
Mock-infected animals showed no measurable colonization (data not shown). As
103
A
B
C
D
E
F
104
B6.SPF
Hf 8 wks
B6.SPF
Hf 16 wks
G
Histological Score
*
Hf Colonization Score
*
*
3
2
*
1
0
B6.SPF
Hf 24 wks
H
B6.SPF
Hf 8 wks
B6.SPF
Hf 16 wks
Animals
*
*
Animals
*
*
3
*
2
*
1
0
I
B6.GB
Hf 8 wks
B6.GB
Hf 16 wks
B6.GB
Hf 24 wks
J
B6.GB
Hf 8 wks
B6.GB
Hf 16 wks
*
K
*
4
*
*
Hf Colonization Score
9
8
7
6
5
4
3
2
1
0
B6.GB
Hf 24 wks
Animals
Animals
Histological Score
B6.SPF
Hf 24 wks
4
9
8
7
6
5
4
3
2
1
0
Hf Colonization Score
Histological Score
4
9
8
7
6
5
4
3
2
1
0
*
3
2
*
1
0
B6.ASF
Hf 8 wks
B6.ASF
Hf 16 wks
B6.ASF
Hf 24 wks
L
Animals
B6.ASF
Hf 8 wks
B6.ASF
Hf 16 wks
B6.ASF
Hf 24 wks
Animals
Figure 1: Disease progression in B6.SPF, B6.GB, and B6.ASF stomachs after H. felis
infection. Panels A, C, and E are representative images of 24 week mock-infected
B6.SPF, B6.GB, and B6.ASF respectively. Panels B, D, and F are 24 week H. felisinfected B6.SPF, B6.GB, and B6.ASF animals. Bar = 50 microns. Panels G, I, and K
show the histological scores over the course of the experiment. Mock-infected mice has
scores similar to unmanipulated control mice. The circles represent the individual scores
for each animal with the horizontal line set at the mean for the data set. Panels H, J, and
K are the HF colonization scores for the three different animal groups. No colonization
was noted in mock-infected controls. *p < 0.05 as compared to respective mocks.
105
expected the B6.SPF gastric H. felis colonization was decreased by 8 weeks, a time point
where inflammation and gastric epithelial alterations were maximal (Fig. 1, Panels G &
H). In contrast, although the histological score remains relatively high in the infected
B6.ASF, the colonization scores increase over the course of the experiment (Fig. 1, Panel
L). The colonization levels are maintained at a mid-level in the B6.GB infected stomachs.
This data implies that the continuing stimulation for gastric inflammation must be
different between the three models, as the B6.GB and B6.ASF continue to be exposed to
H. felis during the entire course of the infection, whereas the B6.SPF are not.
Non-Helicobacter Gastric Bacteria
To test if H. felis infection induces an alteration in the gastric ecological niche and
a subsequent change in colonization with other bacteria, DGGE was performed on DNA
isolated from gastric washes from the three animal models during the course of the
experiment. As shown in Figure 2A, the B6.SPF H. felis infected stomachs demonstrate
additional bacterial bands that are not present in the B6.SPF mock animals, indicating
that gastric colonization with H. felis alters the gastric environment in a way that allows
other bacteria to colonize the stomach. These bacterial bands are not found in the H. felis
infected B6.ASF stomachs indicating that none of the eight ASF strains correspond to
these bacteria bands. This pattern is maintained at 24 weeks of infection (Fig. 2B);
however now the level of H. felis colonization is high enough (>1%) to be visualized on
the DGGE gel. This confirmed the increased colonization seen in Fig. 1L. DGGE
analysis was also preformed on the gastric washes of the B6.GB animals to verify their
germ-free status (data not shown).
106
B6.SPF B6.SPF B6.ASF B6.ASF
mock
Hf
mock
Hf
B6.SPF B6.SPF B6.ASF B6.ASF
mock
Hf
mock
Hf
Hf
A
Hf
B
Figure 2: DGGE on gastric washes from B6.SPF and B6.ASF infected animals. Panel A
are mock- or H. felis- infected for 8 weeks, whereas Panel B are mock- or H. felisinfected for 24 weeks. As an internal positive control DNA was isolated from a culture of
H. felis to show where the bacteria would band, indicated by the arrows. The H. felis
infected animals also have a band at the same length down the gel as the H. felis. Notice
the additional bacteria in the B6.SPF H. felis infected animals that are not in the B6.SPF
mock infected animals, as indicated by the circles.
107
Expression of Muc5ac
Mucins are a gel-like substance that covers the mammalian gastric, as well as
other epithelial surfaces (34, 35). One key mucin, Muc5ac, has been shown to be an
adherence factor for H. pylori (36, 37) and has been demonstrated to have decreased
expression in stomachs afflicted with gastric adenocarcinoma (38, 39). We analyzed the
expression Muc5ac in the three animal models by immunohistochemistry and by qRTPCR expression. Figure 3A shows the expression of Muc5ac by immunhistochemistry as
assessed by a semi-quantative scoring system. The expression of Muc5ac in the three
mock-infected animal groups was similar to normal C57BL/6 mice, while the H. felis
infected animals showed a decrease in expression in all three models. This demonstrates
that the level of Muc5ac expression is not the mechanism for the difference of
colonization levels seen in the three animal models. This data was confirmed with the
qRT-PCR data that showed that Muc5ac expression was similarly decreased in all three
animal models.
Total and H. felis Specific Antibody Responses in the Serum and Feces
Total and H. felis specific antibody responses were assayed in the three mock- and
H. felis-infected animal models. As shown in Figure 4A and C, there was no significant
difference in the amount of total serum IgA and total fecal IgA in any of the animal
models over time. The H. felis-specific serum IgA was similar during the course of the
infection (Fig. 4B), however, the H. felis-specific fecal IgA was decreased in the B6.GB
108
Muc5ac Score
3
2
*
1
0
B6.SPF
mock
B6.SPF
Hf 24 wks
B6.GB
mock
B6.GB
B6.ASF
Hf 24 wks mock
B6.ASF
Hf 24 wks
Animals
A
B
8
4
2
1
9.
8×
2. 10 -04
0×
1
3. 0 -03
9×
1
7. 0 -03
8×
1
0. 0 -03
01
56
0. 25
03
12
0. 5
06
25
0.
12
5
0.
25
0.
5
B6.SPF
B6.GB
B6.ASF
Fold Change (24 weeks)
Figure 3: Muc5ac expression after H. felis infection. Panel A is muc5ac expression as
assessed by immunofluorescence using a 3 point scale for intensity of staining. The
circles represent the individual scores of the animals with the horizontal line at the mean
for the scores for each animal group. Panel B shows the expression of muc5ac by qRTPCR in the three animal groups. The animals are compared back their respective mockinfected controls whose expression is set to equal one. The mean and range for each
experimental group at 24 weeks of infection are shown. * p < 0.05 as compared to
respective mocks.
109
Serum
SerumIgA
IgAanti
antiHfHf
Total Serum IgA
45 45
40 40
B6.SPF
B6.GB
B6.ASF
B6.SPF
B6.SPF
B6.GB
B6.GB
B6.ASF
B6.ASF
30 30
ng/mL
25 25
20 20
15 15
10 10
5 5
0 0
8 weeks
A
35 35
ng/mL
ng/mL
6500
6000
5500
5000
4500
4000
3500
3000
2500
2000
1500
1000
500
0
16 weeks
B
24 weeks
ND
ND ND
ND
88weeks
weeks
16
16 weeks
weeks
Weeks infected with H. felis
Total Fecal IgA
Fecal IgA anti Hf
55000
150
*
50000
125
45000
35000
30000
25000
B6.SPF
B6.GB
B6.ASF
100
ng/mL
B6.SPF
B6.GB
B6.ASF
40000
ng/mL
24 weeks
weeks
24
Weeks
H. felis
felis
Weeksinfected
infectedwith
with H.
20000
75
50
15000
10000
25
5000
ND
0
C
0
8 weeks
16 weeks
24 weeks
D
Weeks infected with H. felis
8 weeks
16 weeks
24 weeks
Weeks infected with H. felis
Figure 4: Total and H. felis-specific antibody responses after H. felis infection. Panel A
is total serum IgA as measured by murine IgA ELISA. Panel B is H. felis specific serum
IgA. Panel C is total fecal IgA and Panel D is H. felis specific fecal IgA. The mean and
standard error are shown. ND = none detected. * p < 0.05.
110
and B6.ASF as compared to B6.SPF, implying that no Helicobacter specific secretory
IgA was produced in these models.
Immune Response
The immune response is a key factor in the inflammation that occurs in the H.
felis infection. Previous data has shown that H.felis is a Th-1 mediated disease (40, 41).
We analyzed the immune response in the animals at 16 and 24 weeks (Table II; epithelial
genes; Table III; immune cytokines; average fold change with +/- range). Figure 5A
shows the expression of IFN, a characteristic Th1 cytokine, at 24 weeks in the three
animal models. The expression level is similar between the animals, showing that even
without the clearance of H. felis the expression of this is not altered. Figure 5B shows the
expression of IL-17, in the three animal groups at 24 weeks of infection. The B6.GB was
significantly increased as compared to the B6.SPF and B6.ASF. The expression of Foxp3
is shown in Figure 5C. The B6.SPF and B6.GB are increased in expression where the
B6.ASF maintained the same level of expression as the mock B6.ASF mice.
111
Table II: Average Fold Change and +/- Range of Epithelial Genes
Gene
B6.SPF
B6.GB
B6.ASF B6.SPF
B6.GB
16 wks
16 wks
16 wks
24 wks
24 wks
Muc5ac
0.183
0.366868
0.381
0.133
0.646
(0.0213 – (0.031 –
(0.071 – (0.013 – (0.084 –
1.57)
4.3305)
2.054)
1.318)
4.99)
TFF1
0.29097
0.50581
0.31
0.398
1.1647
(0.0241 – (0.0311 –
(0.08 –
(0.0549 (0.269 –
1.8257)
8.23)
1.177)
– 2.879)
5.034)
ATPase
0.1048
0.0528
0.038
0.253
0.6685
(0.0082 – (0.0066 – (0.007 – (0.0272 (0.131 –
1.342)
0.425)
0.207)
– 2.363)
3.41)
IF
0.2797
0.00878
0.069
0.165
2.21
(0.0255 – (0.0014 – (0.0095 (0.022 – (0.305 –
3.0667)
0.0563)
– 0.5)
1.224)
15.98)
Pep
0.0254
0.002637 0.005524
0.042
0.113
(0.3113 – (0.00034 (0.00077 (0.0049 (0.011 –
0.0021)
– 1.9)
– 0.04) – 0.349)
1.186)
TSLP
0.5636
0.0266
0.2253
0.736
2.147
(0.0622 – (0.00162 (0.038 – (0.118 – (0.262 –
5.1013)
– 0.4378)
1.33)
4.595)
17.6)
CXCL15
10.895
55.20269
7.18
11.6
122.7
(1.2998 – (8.1063 – (1.511 – (1.348 – (23.77 –
90.81383) 375.9187) 34.126)
99.84)
633.36)
LIX
120.82
2.7
3.02
45.79
390.7
(7.872 –
(0.329 – (0.0687
(3.44 – (56.65 –
1854.2)
22.15)
–
608.83) 2694.7)
132.84)
KC
25.578
0.396
0.863
62.27
37.4
(3.0056 –
(0.03 –
(0.155 –
(7.6 –
(6.43 –
217.66)
5.13)
4.82)
509.67) 217.67)
MIP2
8.8078
0.572
3.586
14.859
115.96
(0.9052 – (0.041 –
(0.475 – (2.08 – (18.58 –
85.704)
8.062)
27.07)
106.14) 723.64)
112
B6.ASF
24 wks
0.0514
(0.0017
– 1.532)
0.683
(0.0804
– 5.8)
0.172
(0.0087
– 3.394)
0.525
(0.06 –
4.58)
0.06
(0.00459
– 0.8)
4.1
(0.427 –
39.136)
7.5
(0.697 –
80.744)
17.939
(1.72 –
187.12)
23.75
(2.13 –
264.72)
7.835
(0.95 –
64.517)
Table III: Average Fold Change and +/- Range of Immune Response
Gene
B6.SPF
B6.GB
B6.ASF
B6.SPF
B6.GB
16 wks
16 wks
16 wks
24 wks
24 wks
23.907
1057.665
13.33
25.59
248.82
IFN
(1.9801 – (76.439 –
(1.45 –
(1.037 –
(22.078 –
288.64)
14634.62)
122.17)
631.59)
2804.362)
IL-17
40.264
21.9072
40.8
30.1
3010.94
(4.9986 – (3.9387 –
(7.098 –
(3.477 –
(774.9 –
324.33)
121.874)
234.63)
260.59)
11699.28)
IL-10
1.991
4.4178
1.46
1.748
12.0587
(0.3272 – (1.3156 –
(0.439 –
(0.2858 –
(2.857 –
12.114)
14.835)
4.88)
10.69)
50.893)
3.8475
0.023
1.84
3.187
31.56
TGF
(0.1957 – (0.00055 – (0.259 –
(0.2534 –
(3.277 –
75.641)
0.974)
13.1)
40.04)
303.92)
Foxp3
5.1321
0.302
1.91
47.88
12.7
(0.5695 – (0.0299 –
(0.29 –
(4.81 –
(1.35 –
46.245)
3.05)
12.58)
476.82)
119.44)
IL-6
1.8098
2.3187
2.22
0.685
10.33
(0.2054 – (0.2969 –
(0.5 –
(0.056 –
(2.625 –
15.95)
18.10756)
10.02)
8.35)
40.66)
7.0693
6.7583
7.556
15.41
42.518
TNF
(0.9439 – (0.8979 –
(1.783 –
(2.15 –
(5.685 –
52.946)
50.8668)
32.017)
110.41)
317.97)
3.1026
0.327
4.732
8.834
66.718
IL-1
(0.244 –
(0.043 –
(0.669 –
(1.47 –
(9.9 –
39.454)
2.5)
33.478)
52.96)
449.82)
MPO
1.216
0.104
1.0389
0.8197
4.377
(0.1836 – (0.0106 –
(0.135 –
(0.1396 –
(0.448 –
8.0563)
1.034)
8.011)
4.8124)
42.74)
113
B6.ASF
24 wks
24.125
(3.71 –
156.785)
3.122
(0.438 –
22.24)
7.185
(0.734 –
70.327)
1.52
(0.14 –
16.5)
0.883
(0.088 –
8.816)
1.93
(0.1719 –
21.70)
10
(1.28 –
78.14)
18.48
(2.377 –
143.59)
2.8979
(0.37 –
22.636)
B6.SPF
B6.GB
64
12
8
25
6
51
2
10
24
20
48
40
96
81
9
16 2
38
4
A
32
8
16
4
2
1
0.
5
B6.ASF
Fold Change (IFN)
24 weeks
B6.SPF
B6.ASF
32
64
12
8
25
6
51
2
10
24
20
48
40
96
81
9
16 2
38
4
8
16
4
2
1
0.
25
0.
5
*
B6.GB
Fold Change (IL-17)
24 weeks
B
B6.SPF
B6.GB
C
51
2
25
6
12
8
64
32
16
8
4
2
1
0.
5
0.
06
25
0.
12
5
0.
25
B6.ASF
Fold Change (Foxp3)
24 weeks
Figure 5: Immune response after H. felis infection in three different animal models.
Panel A (IFN), B (IL-17), and C (Foxp3) is the expression of their respective genes at 24
weeks. The expression of IL-17 was significant in the B6.GB as compared to the other
two infected animal groups. *p < 0.001.
114
DISCUSSION
Our studies show that all three animal models (B6.SPF, B6.GB, B6.ASF) have
similar histological changes after H. felis gastric infection, demonstrating that H. felis
alone is sufficient to induce chronic gastritis, parietal and zymogenic cell loss, and gastric
dysplasia. However, the mechanisms that induce this final common pathway of
inflammation and gastric pathology appear to be different between the three models. One
potential mechanism is that the B6.GB and B6.ASF did not clear the H. felis infection
while the B6.SPF can clear the organisms. Therefore, these two animal models are being
continuously stimulated by H. felis throughout the infection, while the stimulus of the
continued inflammation in the B6.SPF may be through alternative bacteria.
DGGE analysis indicated that over time there are additional bacteria now
colonizing the B6.SPF stomachs that have been infected for 8, 16, or 24 weeks. It is
known that the pH of the stomach becomes more neutral with H. felis infection thus
allowing bacteria that could not normally thrive in the stomach to live there (12, 13).
Similar bands were not seen in the B6.ASF animals, leading us to conclude that it is not
one of these eight bacteria strains that are now colonizing the stomachs. It is currently
unknown if these additional gastric bacteria in the B6.SPF stomachs out-compete the H.
felis for its niche in the stomach or an alternative mechanism is involved.
One alternative mechanism could be loss or continued presence of the
Helicobacter adherence molecule Muc5ac. When the expression of Muc5ac was
examined in this study both by immunohistochemistry, as well as by qRT-PCR, it was
shown that there was decreased expression in all three animal models. This leads to the
115
conclusion that loss of Muc5ac it is not responsible for the difference in clearance of the
H. felis bacteria between the three models.
As antibodies play a role in the clearance of multiple bacteria, we investigated
whether antibodies could be playing a role in the differential clearance of the bacteria in
these mouse models. Although total serum and fecal IgA did not differ between groups,
no H. felis-specific fecal IgA was ever produced in the B6.GB and B6.ASF animals, even
after 24 weeks of infection. Although it remains a possibility that the lack of
Helicobacter-specific secretory IgA is the mechanism behind why these mice are not
clearing the H. felis, we believe that is not the explanation based on our previous studies.
These experiments have shown that the B6.MT animals, which lack B cells and
antibodies, are able to clear H. felis during infection (8). Consequently, the presence or
absence of antibody is probably not responsible for differences in bacterial clearance
during the infection in these mouse models.
Our laboratory has shown that the adaptive immune response, specifically the
CD4+ T-cell, is critical in the development of gastritis and the subsequent gastric
pathology seen after H. felis infection. Therefore, we characterized the expression level
of three representative CD4 T-cell cytokines or transcription factors (Th1-IFN, Th17IL17, and Treg-FoxP3) to determine if a specific T-cell subset was over- or underrepresented in each of these animal models. There was no difference in IFN between
the three animal models showing that this characteristic Th1 cytokine is not responsible
for the clearance of the H. felis, but may play a role in the histological alterations seen in
all three mouse models. As Th17 cells have been shown to play a role in the
development of chronic inflammation in other inflammatory animal models, we
116
examined the level of IL17 expression (42-44). Surprisingly, the B6.GB showed a
significant increase in expression as compared to the B6.SPF and B6.ASF. As the B6.GB
did not contain any other bacteria in the stomach to activate these Th17 cells, it is clear
that H. felis, alone, is sufficient to stimulate IL-17 production and suggests that IL17,
perhaps in conjunction with IFN, is part of the mechanism driving the ongoing chronic
inflammation evident in this model. It is thought that Tregs are involved in suppressing
the immune response in H. pylori infection (45). The B6.SPF and B6.GB had an
increased expression of Foxp3 showing that it is not responsible for the clearance of the
H. felis and that the presence of regulatory T cells are not sufficient to downregulate
chronic gastric inflammation.
These studies have shown that there are multiple immunological mechanisms that
can result in similar gastric histology after H. felis infection. One mechanism appears to
be an altered gastric niche, which allows the colonization of the additional bacteria in the
B6.SPF animals. By limiting the gastric microbiota in the B6.GB and B6.ASF animals,
we have eliminated these additional bacteria from playing a role in their chronic
pathology; however, there appear to be other alternative mechanisms playing a role in
these mice. First, they are unable to clear the H. felis infection, even though there is a
similar loss of the adherence glycoprotein in all three models. Second, they appear
unable to mount a specific secretory anti-H. felis IgA response. The reasons for this lack
of specific secretory response are currently unknown. Third, these strains have
significant alterations in their ability to mount Th17 and Treg responses. The B6.GB
stomach is clearly dominated by a Th17 response after H. felis infection, but still has an
increased Treg response (as measured by Foxp3 expression). However, the B6.ASF
117
model does not appear to generate either Th17 or Tregs in the stomach after H. felis
infection. Clearly, additional studies will be needed to elucidate the specific mechanisms
behind these differences in disease pathology in these unique mouse models. Further
studies are currently underway to elucidate if the dysplastic lesions seen in the 24 week
infected B6.GB and B6.ASF animals will progress to gastric adenocarcinoma in a similar
fashion as the H. felis infected B6.SPF animals.
118
Acknowledgements
This work was supported in part by a grant from the American Cancer Society
(RPG-99-086-01-MBC), National Institutes of Health (NIH) Grants R01 DK-059911 and
P01 DK-071176, and the University of Alabama at Birmingham Digestive Diseases
Research Development Center Grant #P 30 DK-064400. J.M.S. received salary support
from NIH Training Grant T32 AI-07041.
We thank Charyl Roy for technical assistance with the Gnotobiotic and
Genetically Engineered Mouse Core, Jamie McNaught for her work with the Histology
Core, as well as Anna Seay and Scott Tanner for their technical assistance.
119
References
1.
Correa, P., and M. B. Piazuelo. 2008. Natural history of Helicobacter pylori
infection. Dig Liver Dis.
2.
Tan, M. P., M. Kaparakis, M. Galic, J. Pedersen, M. Pearse, O. L. Wijburg, P. H.
Janssen, and R. A. Strugnell. 2007. Chronic Helicobacter pylori infection does not
significantly alter the microbiota of the murine stomach. Appl Environ Microbiol
73:1010.
3.
Peek Jr., R. M. 2002. New insights into microbially initiated gastric malignancies:
Beyond the usual suspects. Gastroenterology 123.
4.
Vanagunas, A. 1998. The Link Between Helicobacter pylori and Gastric Cancer.
Infect Med 15:644.
5.
Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005.
Helicobacter felis eradication restores normal architecture and inhibits gastric
cancer progression in C57BL/6 mice. Gastroenterology 128:1937.
6.
Parkin, D. M., F. Bray, J. Ferlay, and P. Pisani. 2005. Global cancer statistics,
2002. CA Cancer J Clin 55:74.
7.
McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter felis
model of adoptive transfer gastritis. Immunol Res 33:183.
8.
Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular
immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490.
9.
Ogura, K., S. Maeda, M. Nakao, T. Watanabe, M. Tada, T. Kyutoku, H. Yoshida,
Y. Shiratori, and M. Omata. 2000. Virulence factors of Helicobacter pylori
responsible for gastric diseases in Mongolian gerbil. J Exp Med 192:1601.
10.
Watanabe, T., M. Tada, H. Nagai, S. Sasaki, and M. Nakao. 1998. Helicobacter
pylori infection induces gastric cancer in mongolian gerbils. Gastroenterology
115:642.
11.
Savage, D. C. 1977. Microbial ecology of the gastrointestinal tract. Annu Rev
Microbiol 31:107.
12.
Rathinavelu, S., Y. Zavros, and J. L. Merchant. 2003. Acinetobacter lwoffii
infection and gastritis. Microbes Infect 5:651.
120
13.
Zavros, Y., G. Rieder, A. Ferguson, and J. L. Merchant. 2002. Gastritis and
hypergastrinemia due to Acinetobacter lwoffii in mice. Infect Immun 70:2630.
14.
Bik, E. M., P. B. Eckburg, S. R. Gill, K. E. Nelson, E. A. Purdom, F. Francois, G.
Perez-Perez, M. J. Blaser, and D. A. Relman. 2006. Molecular analysis of the
bacterial microbiota in the human stomach. Proc Natl Acad Sci U S A 103:732.
15.
Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent,
S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of the human
intestinal microbial flora. Science 308:1635.
16.
Wang, X., S. P. Heazlewood, D. O. Krause, and T. H. Florin. 2003. Molecular
characterization of the microbial species that colonize human ileal and colonic
mucosa by using 16S rDNA sequence analysis. J Appl Microbiol 95:508.
17.
Savage, D. C., R. Dubos, and R. W. Schaedler. 1968. The gastrointestinal
epithelium and its autochthonous bacterial flora. J Exp Med 127:67.
18.
Yamaguchi, H., T. Osaki, H. Taguchi, N. Sato, A. Toyoda, M. Takahashi, M. Kai,
N. Nakata, A. Komatsu, Y. Atomi, and S. Kamiya. 2003. Effect of bacterial flora
on postimmunization gastritis following oral vaccination of mice with
Helicobacter pylori heat shock protein 60. Clin Diagn Lab Immunol 10:808.
19.
Aebischer, T., A. Fischer, A. Walduck, C. Schlotelburg, M. Lindig, S. Schreiber,
T. F. Meyer, S. Bereswill, and U. B. Gobel. 2006. Vaccination prevents
Helicobacter pylori-induced alterations of the gastric flora in mice. FEMS
Immunol Med Microbiol 46:221.
20.
Lee, A., J. G. Fox, G. Otto, and J. Murphy. 1990. A small animal model of human
Helicobacter pylori active chronic gastritis. Gastroenterology 99:1315.
21.
Fox, J. G., M. Blanco, J. C. Murphy, N. S. Taylor, A. Lee, Z. Kabok, and J.
Pappo. 1993. Local and systemic immune responses in murine Helicobacter felis
active chronic gastritis. Infect Immun 61:2309.
22.
Gordon, H. A., and L. Pesti. 1971. The gnotobiotic animal as a tool in the study of
host microbial relationships. Bacteriol Rev 35:390.
23.
Dewhirst, F. E., C. C. Chien, B. J. Paster, R. L. Ericson, R. P. Orcutt, D. B.
Schauer, and J. G. Fox. 1999. Phylogeny of the defined murine microbiota:
altered Schaedler flora. Appl Environ Microbiol 65:3287.
24.
Sarma-Rupavtarm, R. B., Z. Ge, D. B. Schauer, J. G. Fox, and M. F. Polz. 2004.
Spatial distribution and stability of the eight microbial species of the altered
schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol
70:2791.
121
25.
Schaedler, R. W., R. Dubs, and R. Costello. 1965. Association Of Germfree Mice
With Bacteria Isolated From Normal Mice. J Exp Med 122:77.
26.
Smith, K., K. D. McCoy, and A. J. Macpherson. 2007. Use of axenic animals in
studying the adaptation of mammals to their commensal intestinal microbiota.
Semin Immunol 19:59.
27.
Deloris Alexander, A., R. P. Orcutt, J. C. Henry, J. Baker, Jr., A. C. Bissahoyo,
and D. W. Threadgill. 2006. Quantitative PCR assays for mouse enteric flora
reveal strain-dependent differences in composition that are influenced by the
microenvironment. Mamm Genome 17:1093.
28.
Johnson, M. J., E. Thatcher, and M. E. Cox. 1995. Techniques for controlling
variability in gram staining of obligate anaerobes. J Clin Microbiol 33:755.
29.
McLoughlin, R. M., R. M. Solinga, J. Rich, K. J. Zaleski, J. L. Cocchiaro, A.
Risley, A. O. Tzianabos, and J. C. Lee. 2006. CD4+ T cells and CXC chemokines
modulate the pathogenesis of Staphylococcus aureus wound infections. Proc Natl
Acad Sci U S A 103:10408.
30.
Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem
162:156.
31.
Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time
quantitative PCR. Genome Res 6:986.
32.
Bas, A., G. Forsberg, S. Hammarstrom, and M. L. Hammarstrom. 2004. Utility of
the housekeeping genes 18S rRNA, beta-actin and glyceraldehyde-3-phosphatedehydrogenase for normalization in real-time quantitative reverse transcriptasepolymerase chain reaction analysis of gene expression in human T lymphocytes.
Scand J Immunol 59:566.
33.
Brown, J. K., A. D. Pemberton, S. H. Wright, and H. R. Miller. 2004. Primary
antibody-Fab fragment complexes: a flexible alternative to traditional direct and
indirect immunolabeling techniques. J Histochem Cytochem 52:1219.
34.
Chen, Y., Y. H. Zhao, T. B. Kalaslavadi, E. Hamati, K. Nehrke, A. D. Le, D. K.
Ann, and R. Wu. 2004. Genome-wide search and identification of a novel gelforming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol
30:155.
35.
Kaneko, Y., K. Yanagihara, Y. Miyazaki, Y. Hirakata, H. Mukae, K. Tomono, Y.
Okada, J. Kadota, and S. Kohno. 2003. Overproduction of MUC5AC core protein
in patients with diffuse panbronchiolitis. Respiration 70:475.
122
36.
Van de Bovenkamp, J. H., J. Mahdavi, A. M. Korteland-Van Male, H. A. Buller,
A. W. Einerhand, T. Boren, and J. Dekker. 2003. The MUC5AC glycoprotein is
the primary receptor for Helicobacter pylori in the human stomach. Helicobacter
8:521.
37.
Van den Brink, G. R., K. M. Tytgat, R. W. Van der Hulst, C. M. Van der Loos, A.
W. Einerhand, H. A. Buller, and J. Dekker. 2000. H pylori colocalises with
MUC5AC in the human stomach. Gut 46:601.
38.
Ho, S. B., L. L. Shekels, N. W. Toribara, Y. S. Kim, C. Lyftogt, D. L. Cherwitz,
and G. A. Niehans. 1995. Mucin gene expression in normal, preneoplastic, and
neoplastic human gastric epithelium. Cancer Res 55:2681.
39.
Marques, T., L. David, C. Reis, and A. Nogueira. 2005. Topographic expression
of MUC5AC and MUC6 in the gastric mucosa infected by Helicobacter pylori
and in associated diseases. Pathol Res Pract 201:665.
40.
Mohammadi, M., J. Nedrud, R. Redline, N. Lycke, and S. J. Czinn. 1997. Murine
CD4 T-cell response to Helicobacter infection: TH1 cells enhance gastritis and
TH2 cells reduce bacterial load. Gastroenterology 113:1848.
41.
Bamford, K. B., X. Fan, S. E. Crowe, J. F. Leary, W. K. Gourley, G. K. Luthra, E.
G. Brooks, D. Y. Graham, V. E. Reyes, and P. B. Ernst. 1998. Lymphocytes in
the human gastric mucosa during Helicobacter pylori have a T helper cell 1
phenotype. Gastroenterology 114:482.
42.
Luzza, F., T. Parrello, G. Monteleone, L. Sebkova, M. Romano, R. Zarrilli, M.
Imeneo, and F. Pallone. 2000. Up-regulation of IL-17 is associated with bioactive
IL-8 expression in Helicobacter pylori-infected human gastric mucosa. J Immunol
165:5332.
43.
Mizuno, T., T. Ando, K. Nobata, T. Tsuzuki, O. Maeda, O. Watanabe, M.
Minami, K. Ina, K. Kusugami, R. M. Peek, and H. Goto. 2005. Interleukin-17
levels in Helicobacter pylori-infected gastric mucosa and pathologic sequelae of
colonization. World J Gastroenterol 11:6305.
44.
Weaver, C. T., R. D. Hatton, P. R. Mangan, and L. E. Harrington. 2007. IL-17
family cytokines and the expanding diversity of effector T cell lineages. Annu Rev
Immunol 25:821.
45.
Lundgren, A., E. Suri-Payer, K. Enarsson, A. M. Svennerholm, and B. S. Lundin.
2003. Helicobacter pylori-specific CD4+ CD25high regulatory T cells suppress
memory T-cell responses to H. pylori in infected individuals. Infect Immun
71:1755.
123
CONCLUSIONS
Although many studies have been done on the effects of Helicobacter on disease
progression, there is still much to learn about the immunology and mucin alterations. The
immune response contributes to the severity of the disease, making this a critical piece of
information to understand (7). Through the use of qRT-PCR we have demonstrated that
there is a change in the immune response in infected animals. By combining this
knowledge with experiments done on knock-out animals, we can begin to understand the
mechanism of the disease progression. Initially, studies focused on the expression of
CXCL15 (Lungkine) and its expression throughout the gastrointestinal, urogenital, and
endocrine systems. A we believe that the immune response is only one part of the puzzle,
studies began on studying the mucin and trefoil alternation seen in the C57BL/6 model of
H. felis infection. The results from these two focuses led us to study the effects of the
immune response and mucins changes with an altered microbiota. The studies presented
in this dissertation have demonstrated the importance of the immune system and mucin
alterations in the progression to gastric adenocarcinoma after infection with H. felis.
The expression of CXCL15 in the gastrointestinal, urogenital, and endocrine tract
has not been studied previously. CXCL15 is part of the ELR+ CXC family which are
involved in neutrophil recruitment and promotion of angiogenesis. Its expression has
been shown in the adult lung of inbred mouse strains. However no expression was
evident in lymphoid organs such as the spleen. In response to inflammatory stimuli,
CXCL15 expression is upregulated in the lung being released by the bronchoepithelial
cells (53). It then functions to increase the neutrophil migration into the airway spaces. A
124
knockout of CXCL15 has been created and is shown to have an increased pulmonary
bacterial load when infected with Klebsiella pneumoniae as compared to infected wildtype mice (52). As the neutrophil response has been shown to be increased in mice
infected with H. felis, we needed to evaluate the expression of CXCL15 in the
gastrointestinal tract, as it had not been studied previously (80). At baseline, CXCL15
was expressed in all the organs of the gastrointestinal tract except for the cecum. In a
stomach infected with H. felis for eight weeks there was an increase of CXLC15 by RNA
expression. When analyzing its expression in two models of colitis, also studied in our
lab, it was shown to be decreased, thus not playing a significant role in these two models.
As the H. felis model of infection progresses to gastric adenocarcinoma, CXCL15 could
be playing a key role in the disease. Further studies to analyze the effect of H. felis in a
knockout mouse of CXCL15 could lead to further understanding of the mechanisms.
Attempts have been made to obtain this mouse for our studies, but we have been
unsuccessful in obtaining them. As recent reports have shown that Helicobacterassociated gastric cancer originates in the bone marrow stem cells, it is thought that
CXCL15 could be acting as a chemoattractant for the bone marrow progenitor cells in the
disease model (81, 82).
As the C57BL/6 model is a well-used model for H. felis infection, it is important
to see how closely the model mimics the human disease progression. Previous studies
have been done to analyze the changes of the mucins and trefoil factors in human
stomachs. MUC1 and TFF2 are expressed early in the disease process, whereas MUC2,
MUC3, MUC4, MUC5B, and TFF3 are expressed in gastric adenocarcinomas.
MUC5AC, MUC6, and TFF1 expression is lost in the stomach during the progression to
125
gastric adenocarcinoma (25, 26, 34-37, 83-86). But no comprehensive study has been
done to analyze all the murine mucins and trefoil factors over the course of the disease
progression. Studies have focused on the expression of TFF2 in the mouse model. It was
shown that TFF2-/- infected with H. felis had increased susceptibility to H. felis gastritis,
and the studies suggested a role for TFF2 in controlling gastrointestinal repair but also
regulating mononuclear cell inflammatory responses (38). Our study showed that the
histology mimics what is seen in humans, confirming data from other laboratories (8, 87).
Through an extensive qRT-PCR study the expression of murine mucins and Trefoil
factors were mapped over the course of infection with H. felis in the mouse model. We
showed by qRT-PCR that Muc4, Muc5b, and TFF1 expression mimicked what is known
about these in the human disease. By immunofluorescence, Muc5ac resembles what
happens in the human disease, but since this is not globally lost throughout the entire
stomach, a decrease in RNA expression is not evident. Through the use of
immunofluorescence we were able to confirm that the murine protein expression
correlated with the RNA expression for the murine model for Muc1, Muc3, and Muc4,
although only Muc4 reproduced what is seen in the human disease. While all of our data
did not mimic the human mucin expression, this could be due to the time points of
infection. The human expression of mucins normally is reported in stomachs that are
afflicted with gastric adenocarcinoma, whereas our animal model focused more on the
earlier time points which maps what happens during the course of the infection. By using
the B6.RAG mice we were able to determine the changes that occur with the mucins and
trefoil factors in a model that does contain the adaptive system. Previous studies have
shown that the innate immune system is not sufficient to generate the histological
126
changes seen in the progression to gastric adenocarcinoma (70, 73). There was no change
in Muc4 and Muc5b in the B6.RAG, which were increased in the B6 model, leading us to
conclude that the changes are due to the adaptive immune system. As the changes were
occurring early in the disease, Muc4 and Muc5b could be markers for dysplasia, allowing
doctors to detect the progression to gastric adenocarcinoma earlier.
The immune responses and mucin changes are only part of the puzzle; other
factors are clearly playing a role in the disease progression, especially other bacteria.
Previously the stomach was thought to be sterile but with more sensitive detection
methods, this has been proven false. Earlier studies by other labs have shown that
infection with H. pylori in the mouse model required additional bacteria for the induction
of post-immunization gastritis in the mice. These additional bacteria included bacteria
that are normally located in the lower intestinal tract, thus showing that H. pylori is
potentially enabling these bacteria to adapt to the gastric conditions (88, 89). Unpublished
DGGE data in our lab has shown that mice infected with H. felis for eight weeks showed
additional bands of bacteria not evident in the mock stomachs. This led us to using the
gnotobiotic facility on campus. We infected germ-free (B6.GB) and Altered Schaedler
Flora (B6.ASF) mice with H. felis and analyzed the changes over the course of infection.
The histological changes seen in the B6.GB and B6.ASF mice were similar to what is
seen in our B6 model of infection (B6.SPF). The colonization levels in the B6.GB and
B6.ASF mice did not clear as seen in the B6.SPF infection, thus causing a different
stimulation of inflammation from the B6.SPF, as the B6.GB and B6.ASF were constantly
stimulated with H. felis. The B6.SPF could be receiving stimulation from additional
bacteria that are present in the stomach. We were able to replicate the data seen
127
previously in our lab by DGGE. Stomachs of B6.SPF animals that had been infected for 8
and 24 weeks showed additional bacteria present that were not evident in the mock
animals. When comparing these bacterial bands to the bands seen in the B6.ASF animals,
we observed that they did not correlate, leading us to conclude that one of the eight
strains in the ASF are not the additional bacteria evident in the B6.SPF animals. Further
studies would be needed to determine exactly what bacteria are evident in these bands.
Once these are determined dual infection in a germ-free mouse with H. felis and a
bacterium that is evident in the B6.SPF animal could determine whether these additional
bacteria are needed for the progression to gastric adenocarcinoma. Since the lost of
Muc5ac is a crucial concept in the human and mouse models, we analyzed its expression
in the altered microbiota animal models to determine if bacteria are playing a role in its
decreased expression. Expression was analyzed by qRT-PCR and immunofluorescene,
showing no difference in the expression level as compared to the B6.SPF infected
animals. The change in the microbiota does not play a role in the loss of Muc5ac in this
disease. As antibodies are thought to play a role in the clearance of multiple bacteria, we
analyzed the expression levels in the three animal models. The B6.GB and B6.ASF did
not produce fecal Helicobacter specific IgA over the course of the infection. This lack of
production could explain why these animals did not clear H. felis, but studies on B6.MT
have shown that antibodies are not necessary for the clearance of H. felis (70). As the
immune response is altered in the mouse model of disease, we wondered whether the
same changes still occur in the altered microbiota. All three models had an increase of
IFN, which is characteristic of the Th1 response seen in Helicobacter disease. IL-17 was
highly upregulated in the B6.GB animals and increased in the B6.SPF. Interestingly in
128
the B6.ASF there was no change from baseline, suggesting that the eight bacteria present
are not stimulators of IL-17. Foxp3 was increased in the B6.SPF and B6.GB but was not
changed in B6.ASF. This shows that one of the eight bacteria of the ASF could be
playing a role in the lack of change seen in the T regulatory response. Infection of the
B6.GB and B6.ASF animals for one year with H. felis would allow us to elucidate if the
altered microbiota coordinates to the development of gastric adenocarcinoma.
We have characterized the expression of CXCL15 expression in the
gastrointestinal, uorgenital, and endocrine tract, showing that it is not limited to the lung
only. This expression could lead to discovering its role in inflammatory diseases other
than pulmonary infections. While the changes in mucins and trefoil factors are widely
known in the human disease, no one has attempted to characterize all the changes seen in
the mouse model. To be able to diagnose an individual early in the disease process, the
changes seen early on in the infection need to be better understood. The disease
progression was analyzed in an altered microbiota state to determine if there was a key
bacterium causing the immune response. Figure 5 is a summary of the knowledge of the
disease progression that has been obtained in my research here. My hypothesis set out to
prove that there was a sequence of events leading to cancer, starting with immune
changes which then led to changes in the mucins followed by gastric adenocarcinoma.
While the key cytokine has not been determined in the model, showing how little we
completely understand about the disease, there is evidence that mucin changes are
extremely important both in the human disease and in the mouse model.
129
Normal
Colonization of H. felis
Chronic gastritis
Increase in CXCL15
Atrophy
Loss of parietal cells = increased
pH (other bacteria)
Loss of muc5ac and TFF1
Appearance of muc4 and muc5b
Increase in IL-17, IFN, and Foxp3
Metaplasia
Disappearance of H. felis
Adenocarcinoma
Figure 1: Diagram of the histological changes in the progression to gastric
adenocarcinoma. The boxes to the right of the figure indicate what is now known in the
mouse model of the disease.
130
GENERAL LIST OF REFERENCES
1.
Peek Jr., R. M. 2002. New insights into microbially initiated gastric malignancies:
Beyond the usual suspects. Gastroenterology 123.
2.
Vanagunas, A. 1998. The Link Between Helicobacter pylori and Gastric Cancer.
Infect Med 15:644.
3.
Hohenberger, P. G., Stephan. 2003. Gastric Cancer. The Lancet 362:305.
4.
Lauren, P. 1965. The Two Histological Main Types Of Gastric Carcinoma:
Diffuse And So-Called Intestinal-Type Carcinoma. An Attempt At A HistoClinical Classification. Acta Pathol Microbiol Scand 64:31.
5.
Warren, B. J. M. J. R. 1984. Unidentified Curved Bacilli in the Stomach of
Patients with Gastritis and Peptic Ulceration. The Lancet 8390:1311.
6.
Clyne, M., P. Dillon, S. Daly, R. O'Kennedy, F. E. May, B. R. Westley, and B.
Drumm. 2004. Helicobacter pylori interacts with the human single-domain trefoil
protein TFF1. Proc Natl Acad Sci U S A 101:7409.
7.
Telford, J. L., A. Covacci, R. Rappuoli, and P. Chiara. 1997. Immunobiology of
Helicobacter pylori infection. Curr Opin Immunol 9:498.
8.
Cai, X., J. Carlson, C. Stoicov, H. Li, T. C. Wang, and J. Houghton. 2005.
Helicobacter felis eradication restores normal architecture and inhibits gastric
cancer progression in C57BL/6 mice. Gastroenterology 128:1937.
9.
Katoh, M. 2003. Trefoil factors and human gastric cancer (review). Int J Mol Med
12:3.
10.
Fox, J. G., and T. C. Wang. 2007. Inflammation, atrophy, and gastric cancer. J
Clin Invest 117:60.
11.
Karnes, W. E., Jr., I. M. Samloff, M. Siurala, M. Kekki, P. Sipponen, S. W. Kim,
and J. H. Walsh. 1991. Positive serum antibody and negative tissue staining for
Helicobacter pylori in subjects with atrophic body gastritis. Gastroenterology
101:167.
12.
Kikuchi, S. 2002. Epidemiology of Helicobacter pylori and gastric cancer. Gastric
Cancer 5:6.
13.
Thompson, L. J., S. J. Danon, J. E. Wilson, J. L. O'Rourke, N. R. Salama, S.
Falkow, H. Mitchell, and A. Lee. 2004. Chronic Helicobacter pylori infection
131
with Sydney strain 1 and a newly identified mouse-adapted strain (Sydney strain
2000) in C57BL/6 and BALB/c mice. Infect Immun 72:4668.
14.
Ito, S. 1987. Functional Gastric Morphology. In Physiology of the
Gastrointestinal Tract, p. 817.
15.
Cahill, R. J., C. Kilgallen, S. Beattie, H. Hamilton, and C. O'Morain. 1996.
Gastric epithelial cell kinetics in the progression from normal mucosa to gastric
carcinoma. Gut 38:177.
16.
Lynch, D. A., N. P. Mapstone, A. M. Clarke, G. M. Sobala, P. Jackson, L.
Morrison, M. F. Dixon, P. Quirke, and A. T. Axon. 1995. Cell proliferation in
Helicobacter pylori associated gastritis and the effect of eradication therapy. Gut
36:346.
17.
Chen, Y., Y. H. Zhao, T. B. Kalaslavadi, E. Hamati, K. Nehrke, A. D. Le, D. K.
Ann, and R. Wu. 2004. Genome-wide search and identification of a novel gelforming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol
30:155.
18.
Kaneko, Y., K. Yanagihara, Y. Miyazaki, Y. Hirakata, H. Mukae, K. Tomono, Y.
Okada, J. Kadota, and S. Kohno. 2003. Overproduction of MUC5AC core protein
in patients with diffuse panbronchiolitis. Respiration 70:475.
19.
Shirazi, T., R. J. Longman, A. P. Corfield, and C. S. Probert. 2000. Mucins and
inflammatory bowel disease. Postgrad Med J 76:473.
20.
Higuchi, T., T. Orita, S. Nakanishi, K. Katsuya, H. Watanabe, Y. Yamasaki, I.
Waga, T. Nanayama, Y. Yamamoto, W. Munger, H. W. Sun, R. J. Falk, J. C.
Jennette, D. A. Alcorta, H. Li, T. Yamamoto, Y. Saito, and M. Nakamura. 2004.
Molecular cloning, genomic structure, and expression analysis of MUC20, a
novel mucin protein, up-regulated in injured kidney. J Biol Chem 279:1968.
21.
Ringel, J., and M. Lohr. 2003. The MUC gene family: their role in diagnosis and
early detection of pancreatic cancer. Mol Cancer 2:9.
22.
Kawakubo, M., Y. Ito, Y. Okimura, M. Kobayashi, K. Sakura, S. Kasama, M. N.
Fukuda, M. Fukuda, T. Katsuyama, and J. Nakayama. 2004. Natural antibiotic
function of a human gastric mucin against Helicobacter pylori infection. Science
305:1003.
23.
Escande, F., N. Porchet, A. Bernigaud, D. Petitprez, J. P. Aubert, and M. P.
Buisine. 2004. The mouse secreted gel-forming mucin gene cluster. Biochim
Biophys Acta 1676:240.
132
24.
Babu, S. D., V. Jayanthi, N. Devaraj, C. A. Reis, and H. Devaraj. 2006.
Expression profile of mucins (MUC2, MUC5AC and MUC6) in Helicobacter
pylori infected pre-neoplastic and neoplastic human gastric epithelium. Mol
Cancer 5:10.
25.
Ho, S. B., L. L. Shekels, N. W. Toribara, Y. S. Kim, C. Lyftogt, D. L. Cherwitz,
and G. A. Niehans. 1995. Mucin gene expression in normal, preneoplastic, and
neoplastic human gastric epithelium. Cancer Res 55:2681.
26.
Pinto-de-Sousa, J., C. A. Reis, L. David, A. Pimenta, and M. Cardoso-deOliveira. 2004. MUC5B expression in gastric carcinoma: relationship with
clinico-pathological parameters and with expression of mucins MUC1, MUC2,
MUC5AC and MUC6. Virchows Arch 444:224.
27.
Spicer, A. P., G. J. Rowse, T. K. Lidner, and S. J. Gendler. 1995. Delayed
mammary tumor progression in Muc-1 null mice. J Biol Chem 270:30093.
28.
Lee, H. S., H. K. Lee, H. S. Kim, H. K. Yang, Y. I. Kim, and W. H. Kim. 2001.
MUC1, MUC2, MUC5AC, and MUC6 expressions in gastric carcinomas: their
roles as prognostic indicators. Cancer 92:1427.
29.
Velcich, A., W. Yang, J. Heyer, A. Fragale, C. Nicholas, S. Viani, R.
Kucherlapati, M. Lipkin, K. Yang, and L. Augenlicht. 2002. Colorectal cancer in
mice genetically deficient in the mucin Muc2. Science 295:1726.
30.
Ruchaud-Sparagano, M. H., B. R. Westley, and F. E. May. 2004. The trefoil
protein TFF1 is bound to MUC5AC in human gastric mucosa. Cell Mol Life Sci
61:1946.
31.
Lefebvre, O., M. P. Chenard, R. Masson, J. Linares, A. Dierich, M. LeMeur, C.
Wendling, C. Tomasetto, P. Chambon, and M. C. Rio. 1996. Gastric mucosa
abnormalities and tumorigenesis in mice lacking the pS2 trefoil protein. Science
274:259.
32.
Farrell, J. J. T., Douglas; Koh, Theodore J.; Chen, Duan; Zhao, Chun-Mei;
Podolsky, Daniel K.; and Wang, Timothy C. 2002. TFF2/SP-deficient mice show
decreased gastric proliferation, increased acid secretion, and increased
susceptibility to NSAID injury. J Clin. Invest 109:193.
33.
Mashimo, H., D. C. Wu, D. K. Podolsky, and M. C. Fishman. 1996. Impaired
defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science
274:262.
34.
Roessler, K., S. P. Monig, P. M. Schneider, F. G. Hanisch, S. Landsberg, J.
Thiele, A. H. Holscher, H. P. Dienes, and S. E. Baldus. 2005. Co-expression of
133
CDX2 and MUC2 in gastric carcinomas: correlations with clinico-pathological
parameters and prognosis. World J Gastroenterol 11:3182.
35.
Dhar, D. K., T. C. Wang, H. Tabara, Y. Tonomoto, R. Maruyama, M. Tachibana,
H. Kubota, and N. Nagasue. 2005. Expression of trefoil factor family members
correlates with patient prognosis and neoangiogenesis. Clin Cancer Res 11:6472.
36.
Marques, T., L. David, C. Reis, and A. Nogueira. 2005. Topographic expression
of MUC5AC and MUC6 in the gastric mucosa infected by Helicobacter pylori
and in associated diseases. Pathol Res Pract 201:665.
37.
Hu, G. Y., B. P. Yu, W. G. Dong, M. Q. Li, J. P. Yu, H. S. Luo, and Z. X. Rang.
2003. Expression of TFF2 and Helicobacter pylori infection in carcinogenesis of
gastric mucosa. World J Gastroenterol 9:910.
38.
Kurt-Jones, E. A., L. Cao, F. Sandor, A. B. Rogers, M. T. Whary, P. R. Nambiar,
A. Cerny, G. Bowen, J. Yan, S. Takaishi, A. L. Chi, G. Reed, J. Houghton, J. G.
Fox, and T. C. Wang. 2007. Trefoil family factor 2 is expressed in murine gastric
and immune cells and controls both gastrointestinal inflammation and systemic
immune responses. Infect Immun 75:471.
39.
O'Keeffe, J., and A. P. Moran. 2008. Conventional, regulatory, and
unconventional T cells in the immunologic response to Helicobacter pylori.
Helicobacter 13:1.
40.
Lundgren, A., E. Suri-Payer, K. Enarsson, A. M. Svennerholm, and B. S. Lundin.
2003. Helicobacter pylori-specific CD4+ CD25high regulatory T cells suppress
memory T-cell responses to H. pylori in infected individuals. Infect Immun
71:1755.
41.
Luzza, F., T. Parrello, G. Monteleone, L. Sebkova, M. Romano, R. Zarrilli, M.
Imeneo, and F. Pallone. 2000. Up-regulation of IL-17 is associated with bioactive
IL-8 expression in Helicobacter pylori-infected human gastric mucosa. J Immunol
165:5332.
42.
Mizuno, T., T. Ando, K. Nobata, T. Tsuzuki, O. Maeda, O. Watanabe, M.
Minami, K. Ina, K. Kusugami, R. M. Peek, and H. Goto. 2005. Interleukin-17
levels in Helicobacter pylori-infected gastric mucosa and pathologic sequelae of
colonization. World J Gastroenterol 11:6305.
43.
Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M.
Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells
develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat
Immunol 6:1123.
134
44.
Kolls, J. K., and A. Linden. 2004. Interleukin-17 family members and
inflammation. Immunity 21:467.
45.
Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L.
Hood, Z. Zhu, Q. Tian, and C. Dong. 2005. A distinct lineage of CD4 T cells
regulates tissue inflammation by producing interleukin 17. Nat Immunol 6:1133.
46.
Steinman, L. 2007. A brief history of T(H)17, the first major revision in the
T(H)1/T(H)2 hypothesis of T cell-mediated tissue damage. Nat Med 13:139.
47.
Weaver, C. T., R. D. Hatton, P. R. Mangan, and L. E. Harrington. 2007. IL-17
family cytokines and the expanding diversity of effector T cell lineages. Annu Rev
Immunol 25:821.
48.
McAllister, F., A. Henry, J. L. Kreindler, P. J. Dubin, L. Ulrich, C. Steele, J. D.
Finder, J. M. Pilewski, B. M. Carreno, S. J. Goldman, J. Pirhonen, and J. K. Kolls.
2005. Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related
oncogene-alpha and granulocyte colony-stimulating factor in bronchial
epithelium: implications for airway inflammation in cystic fibrosis. J Immunol
175:404.
49.
Chen, Y., P. Thai, Y. H. Zhao, Y. S. Ho, M. M. DeSouza, and R. Wu. 2003.
Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6
paracrine/autocrine loop. J Biol Chem 278:17036.
50.
Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P.
Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, J. E. Shellito, G. J.
Bagby, S. Nelson, K. Charrier, J. J. Peschon, and J. K. Kolls. 2001. Requirement
of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte
colony-stimulating factor expression, neutrophil recruitment, and host defense. J
Exp Med 194:519.
51.
Barnes, P. J. 2003. Cytokine-directed therapies for the treatment of chronic
airway diseases. Cytokine Growth Factor Rev 14:511.
52.
Chen, S. C., B. Mehrad, J. C. Deng, G. Vassileva, D. J. Manfra, D. N. Cook, M.
T. Wiekowski, A. Zlotnik, T. J. Standiford, and S. A. Lira. 2001. Impaired
pulmonary host defense in mice lacking expression of the CXC chemokine
lungkine. J Immunol 166:3362.
53.
Rossi, D. L., S. D. Hurst, Y. Xu, W. Wang, S. Menon, R. L. Coffman, and A.
Zlotnik. 1999. Lungkine, a novel CXC chemokine, specifically expressed by lung
bronchoepithelial cells. J Immunol 162:5490.
135
54.
Maheshwari, A., R. D. Christensen, D. A. Calhoun, R. A. Dimmitt, and A.
Lacson. 2004. Circulating CXC-chemokine concentrations in a murine intestinal
ischemia-reperfusion model. Fetal Pediatr Pathol 23:145.
55.
Braunstahl, G. J. 2005. The unified immune system: respiratory tractnasobronchial interaction mechanisms in allergic airway disease. J Allergy Clin
Immunol 115:142.
56.
Mestecky, J., J. R. McGhee, S. M. Michalek, R. R. Arnold, S. S. Crago, and J. L.
Babb. 1978. Concept of the local and common mucosal immune response. Adv
Exp Med Biol 107:185.
57.
Busse, P. J., T. F. Zhang, K. Srivastava, B. P. Lin, B. Schofield, S. C. Sealfon,
and X. M. Li. 2005. Chronic exposure to TNF-alpha increases airway mucus gene
expression in vivo. J Allergy Clin Immunol 116:1256.
58.
Suri-Payer, E., and B. Fritzsching. 2006. Regulatory T cells in experimental
autoimmune disease. Springer Semin Immunopathol 28:3.
59.
Mocellin, S., F. M. Marincola, and H. A. Young. 2005. Interleukin-10 and the
immune response against cancer: a counterpoint. J Leukoc Biol.
60.
Rennick, D., N. Davidson, and D. Berg. 1995. Interleukin-10 gene knock-out
mice: a model of chronic inflammation. Clin Immunol Immunopathol 76:S174.
61.
Matsumoto, Y., T. G. Blanchard, M. L. Drakes, M. Basu, R. W. Redline, A. D.
Levine, and S. J. Czinn. 2005. Eradication of Helicobacter pylori and resolution
of gastritis in the gastric mucosa of IL-10-deficient mice. Helicobacter 10:407.
62.
Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon-gamma:
an overview of signals, mechanisms and functions. J Leukoc Biol 75:163.
63.
Fukao, T., S. Matsuda, and S. Koyasu. 2000. Synergistic effects of IL-4 and IL-18
on IL-12-dependent IFN-gamma production by dendritic cells. J Immunol 164:64.
64.
Crabtree, J. E. 1996. Gastric mucosal inflammatory responses to Helicobacter
pylori. Aliment Pharmacol Ther 10 Suppl 1:29.
65.
Smythies, L. E., K. B. Waites, J. R. Lindsey, P. R. Harris, P. Ghiara, and P. D.
Smith. 2000. Helicobacter pylori-induced mucosal inflammation is Th1 mediated
and exacerbated in IL-4, but not IFN-gamma, gene-deficient mice. J Immunol
165:1022.
66.
El-Omar, E. M., M. Carrington, W. H. Chow, K. E. McColl, J. H. Bream, H. A.
Young, J. Herrera, J. Lissowska, C. C. Yuan, N. Rothman, G. Lanyon, M. Martin,
136
J. F. Fraumeni, Jr., and C. S. Rabkin. 2000. Interleukin-1 polymorphisms
associated with increased risk of gastric cancer. Nature 404:398.
67.
Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095.
68.
Wallace, J. L., M. Cucala, K. Mugridge, and L. Parente. 1991. Secretagoguespecific effects of interleukin-1 on gastric acid secretion. Am J Physiol 261:G559.
69.
Bodger, K., and J. E. Crabtree. 1998. Helicobacter pylori and gastric
inflammation. Br Med Bull 54:139.
70.
Roth, K. A., S. B. Kapadia, S. M. Martin, and R. G. Lorenz. 1999. Cellular
immune responses are essential for the development of Helicobacter felisassociated gastric pathology. J Immunol 163:1490.
71.
Mombaerts, P., J. Iacomini, R. S. Johnson, K. Herrup, S. Tonegawa, and V. E.
Papaioannou. 1992. RAG-1-deficient mice have no mature B and T lymphocytes.
Cell 68:869.
72.
Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell-deficient mouse
by targeted disruption of the membrane exon of the immunoglobulin mu chain
gene. Nature 350:423.
73.
McCracken, V. J., S. M. Martin, and R. G. Lorenz. 2005. The Helicobacter felis
model of adoptive transfer gastritis. Immunol Res 33:183.
74.
Rathinavelu, S., Y. Zavros, and J. L. Merchant. 2003. Acinetobacter lwoffii
infection and gastritis. Microbes Infect 5:651.
75.
Zavros, Y., G. Rieder, A. Ferguson, and J. L. Merchant. 2002. Gastritis and
hypergastrinemia due to Acinetobacter lwoffii in mice. Infect Immun 70:2630.
76.
Gordon, H. A., and L. Pesti. 1971. The gnotobiotic animal as a tool in the study of
host microbial relationships. Bacteriol Rev 35:390.
77.
Dewhirst, F. E., C. C. Chien, B. J. Paster, R. L. Ericson, R. P. Orcutt, D. B.
Schauer, and J. G. Fox. 1999. Phylogeny of the defined murine microbiota:
altered Schaedler flora. Appl Environ Microbiol 65:3287.
78.
Sarma-Rupavtarm, R. B., Z. Ge, D. B. Schauer, J. G. Fox, and M. F. Polz. 2004.
Spatial distribution and stability of the eight microbial species of the altered
schaedler flora in the mouse gastrointestinal tract. Appl Environ Microbiol
70:2791.
79.
Schaedler, R. W., R. Dubs, and R. Costello. 1965. Association Of Germfree Mice
With Bacteria Isolated From Normal Mice. J Exp Med 122:77.
137
80.
Dundon, W. G., H. Nishioka, A. Polenghi, E. Papinutto, G. Zanotti, P.
Montemurro, G. G. Del, R. Rappuoli, and C. Montecucco. 2002. The neutrophilactivating protein of Helicobacter pylori. Int J Med Microbiol 291:545.
81.
Houghton, J., C. Stoicov, S. Nomura, A. B. Rogers, J. Carlson, H. Li, X. Cai, J. G.
Fox, J. R. Goldenring, and T. C. Wang. 2004. Gastric cancer originating from
bone marrow-derived cells. Science 306:1568.
82.
Ohneda, O., K. Ohneda, H. Nomiyama, Z. Zheng, S. A. Gold, F. Arai, T.
Miyamoto, B. E. Taillon, R. A. McIndoe, R. A. Shimkets, D. A. Lewin, T. Suda,
and L. A. Lasky. 2000. WECHE: a novel hematopoietic regulatory factor.
Immunity 12:141.
83.
Muller, W., and F. Borchard. 1993. pS2 protein in gastric carcinoma and normal
gastric mucosa: association with clincopathological parameters and patient
survival. J Pathol 171:263.
84.
Taupin, D., J. Pedersen, M. Familari, G. Cook, N. Yeomans, and A. S. Giraud.
2001. Augmented intestinal trefoil factor (TFF3) and loss of pS2 (TFF1)
expression precedes metaplastic differentiation of gastric epithelium. Lab Invest
81:397.
85.
Wang, R. Q., and D. C. Fang. 2006. Effects of Helicobacter pylori infection on
mucin expression in gastric carcinoma and pericancerous tissues. J Gastroenterol
Hepatol 21:425.
86.
Wong, W. M., R. Poulsom, and N. A. Wright. 1999. Trefoil peptides. Gut 44:890.
87.
Correa, P., and J. Houghton. 2007. Carcinogenesis of Helicobacter pylori.
Gastroenterology 133:659.
88.
Aebischer, T., A. Fischer, A. Walduck, C. Schlotelburg, M. Lindig, S. Schreiber,
T. F. Meyer, S. Bereswill, and U. B. Gobel. 2006. Vaccination prevents
Helicobacter pylori-induced alterations of the gastric flora in mice. FEMS
Immunol Med Microbiol 46:221.
89.
Yamaguchi, H., T. Osaki, H. Taguchi, N. Sato, A. Toyoda, M. Takahashi, M. Kai,
N. Nakata, A. Komatsu, Y. Atomi, and S. Kamiya. 2003. Effect of bacterial flora
on postimmunization gastritis following oral vaccination of mice with
Helicobacter pylori heat shock protein 60. Clin Diagn Lab Immunol 10:808.
138
139

Benzer belgeler